Busch Lab

ZMP

igf1ra

Ensembl ID:
ENSDARG00000027423
ZFIN ID:
ZDB-GENE-020503-1
Description:
insulin-like growth factor 1a receptor [Source:RefSeq peptide;Acc:NP_694500]
Human Orthologue:
IGF1R
Human Description:
insulin-like growth factor 1 receptor [Source:HGNC Symbol;Acc:5465]
Mouse Orthologue:
Igf1r
Mouse Description:
insulin-like growth factor I receptor Gene [Source:MGI Symbol;Acc:MGI:96433]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa43094 Nonsense Mutation detected in F1 DNA Not yet available
sa36640 Nonsense Available for shipment Available now
sa9079 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa36639 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43094
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010189 Nonsense 263 1405 3 21

The following transcripts of ENSDARG00000027423 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 20703814)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20934037
GRCz11 18 20923103
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGAAGCAGACAATGATAAAGCATGCGCCGCCTGCCAGCATTACTTTCAC[G/T]AGGACCGATGTGTCGAGGCCTGCCCGCCAGATACCTACAAGTTTGAAGGA
Long Flanking Sequence:
ATTTGCAGATGAATCAATATCTGAAATTTTGTACATGTATTCAGAAGGACTGTATTTTTGCATCACATATGGAAATTTGTCAAATACTGGAATTTCATTGGCCGTTGTGCTTGTCTACATGATCGTACTGCATGCTGGCAATCAAACTTTTGACCCTGATGGCCTTCCGTACATGACAGTTTTTCTCTTATACAAGTTCCTAAATTGCTTAATAAATTACTAATCTTACAGTATAACTGACTTTTATCTGGTTTACGCCTCAGGAGGTTTTTAAAAATGTTAATTTTAGGATGTTTCCTTGTATACTAAAACTGACATTTCTTTTGTAACAGCAACTGACGTGTTCTCTTTATTTGTGTTCTTCTTTTCCAGTGTGTCCTAAGGAGTGTGAGAAGAGAGCGTGCACGGATGCGGGCCAGTGTTGTCACCCCCAGTGCCTGGGCAGCTGTACGGAAGCAGACAATGATAAAGCATGCGCCGCCTGCCAGCATTACTTTCAC[G/T]AGGACCGATGTGTCGAGGCCTGCCCGCCAGATACCTACAAGTTTGAAGGATGGCGCTGCATCACTATGGAGATGTGTGCCCGTGTTCACCTACCCAGCGAGGTGGACTTCGTCATTCACAATGGAGAGTGTATGCCGGACTGTCCACCCGGATTCACCCGAAATGAGACTCAGAGGTACGACACTAGAAATGCCTTATTAGATGCCGGTGTCAGTAGTGTTTCCTTTACTGTATATAGTGATGCTGCCGTGCCATTTAAACACAGAAAACAGCAGGGGTTGTTGAGTGCGTGAAGTGTCCATCATTACACATTTCATTTTACCGGTTGAATAAGTGCATCATCTGGGTATTTAAAGTGCACTTTTTTGAGGAGGGGGGGTTCTCAGTGTGAACGCATTACTTACGCTGTTTTTACTACAAAATGGCATAGAATAGTGCTTATTTATGCTACTTGGAATGCGCCTAAAAACGTAGGCGTACTACATTCGCCATTTTATCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29028
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010189 Nonsense 406 1405 5 21

The following transcripts of ENSDARG00000027423 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 20699858)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20930081
GRCz11 18 20919147
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCACACTCATACTCTGGGCTCTCTGTCCTTCCTCAAGAGCCTGCGATA[C/A]ATTGTTGGAGAAGAGCTTGTGGATAAGTAAGTAAACAGTTAAAGCACAGA
Long Flanking Sequence:
AGTTGCAACCTAAACTAAAAATAGCCTCAAACGTGCATTATGTTGTCCAATAGCTGCAATATTAGTCAAACTGTAGAGTGTCCTCTGCTTGTTACTGTTTGTGGGTGGAGTAATACACAAAGGTAAGGGGTGAAGAGGCTGGACGTGTGCTGTTACTGTCAGAATATTGCACAGCTATCAGCCAATCAGATTTAAAAACCAGACAAAACTGTTGTATAAACAAATATAATCACTACAAAATTTGTATTTTCAATTATATAATTATTACTTTAAATTAAAACAGGTTATCAACATCCAGTAAGCATGAATGATTTAATTATTAAATGATTAGGAATTGAGGTGATTAATGTTATTGAGTGTCTCTTTGCCTCTGTTTCTTCAGATAACATTGCATCAGAGCTGGAGAGTTTCATGGGGCTGATCCAGACAGTGACTGGATATGTAAGGATCAAGCACACTCATACTCTGGGCTCTCTGTCCTTCCTCAAGAGCCTGCGATA[C/A]ATTGTTGGAGAAGAGCTTGTGGATAAGTAAGTAAACAGTTAAAGCACAGAACTATTGTGGTGACGTTTGGATGATTGATTGTGGACTGAGCAGAGCGGTGTCTGGAAAACAGGTGTCGTGTACATGATAAATGTCTCGCTCAACAGCAGATATTTGCTGGCCGGTTTCAATTGAAGATCATTTCATGGTTTGATCTATATGTTGATATAATTAAGAAGATATTTGACAGCTCTTTATCTCAGGGGTTGTGTTAGACTTTCTGCCATCAGCTATAATTATTTGTCTTTTTATTTTTATTTATTATACTTTTTTATCGCAATTAGTTGCATTGCATTTTTTGTCATGTGGAACAGATTTAAAACGAAAACAATCATTTAAGAGTTGGGTACCTTCCTCTATTTTTCTGTAGTAAGCCATTCATGTGAGCCCTGCAGTTGTAGTACAGTACTCAGACACACGCCAAATGCTTTCATTGGTTGAGACTTATGATGACGCAACCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29027
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010189 Nonsense 429 1405 6 21

The following transcripts of ENSDARG00000027423 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 20698153)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20928376
GRCz11 18 20917442
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTACAGTACATACGCATTCCATGCAGTGGACAATCACAACTTGCAGTA[T/A]CTCTGGGACTGGACTCAGCACAATCTGACCATTAAAACGGGGAAACTATA
Long Flanking Sequence:
TTCATTAAACCGGACTCTGTAAAAATAATACAAAATGTACAGAAGGGCTAATGGTTTTATATATTCTATATTTAATTATGATTGTTTTTTCTGTTCATCTTCTGTCAGATGTTTGCTCTCCTGGCGTAAGTTTTGTGGAGGATGTGTGAGGGAGGCTGTGGGAACTTTTGTGTTGTGATCTCACTAGGGTTGAGATTTGTCTCCAGAAATGCTTGTAAAGCGGCGCAGACATTCTCCGCGTTCCTGAGCTGTTCAGTGCAGCTGTAGAAATCATCTTAACCCTCTTCTGAGCCCTGATCTCCAATCGGGCTTTACTGAAATACAATCTGTGCACGTGCTTCAGTTGTTGTTTTCACACATACCGCATTCGTCATGTGTACAATCAGATCTGATCACTTTCATTCCATTCCATTTTTCTTATATTAATAATGATCTTTGTAAATGTTTGTGTGTTACAGTACATACGCATTCCATGCAGTGGACAATCACAACTTGCAGTA[T/A]CTCTGGGACTGGACTCAGCACAATCTGACCATTAAAACGGGGAAACTATACTTTCGCTTCAATCCCAAGCTTTGCATGTCTGAGATCCGAAAAATGTGGGAGAAAACCAGCGTCAGGGAAAAGATGGCAGAGGACGATGTTCGTAGCAATGGAGAGCGAGCAAGTTGTGAGTAGACAAAGCTTTTCTCTCAATGACTAGAGGTGTAAATCTTTAGTGAAATAAAATGCAGTGTGTGAGGATTCAACAGTACAATGAGTCTTGATGGATCACAATGCTTCTTTGGTTCTTTTATTCATTTTAGTTATACACTAGAATAAGTTATCTGAGTCATTGCAGAGATGTATGGATGCAGTCATCCAAGCTCATGGGAGTCATACACAATATTCGTTCTTTTTCCACTGCACTATGACTTTAGATTCTGTACTGTACATTATTTCTGGTAGATGACAAGTCTTTTGTCTAAGCAAAGTCAGACCTTACTGTCTTAATTAAATAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36640
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010189 Nonsense 524 1405 7 21

The following transcripts of ENSDARG00000027423 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 20695341)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20925564
GRCz11 18 20914630
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGATATCGACCGCCAGACTACAGAGACCTCATCAGCTTCATTGTGTATTA[C/A]AAGGAGGCGTAAGTACCAGTTACTATTGTAAACCTATTTTTCACTTCCAG
Long Flanking Sequence:
CGGCCGTTTGAGTTGGTTGGTAGACGGCAGCGTTATCTCATTACTCAAGCCTTTTAAAATGCAGTTTGCTCCTCAGGTGTCCCGGTAGTCCTTCGCTATCTGCTTCCCTATTATGCCTTTGACAGATTTCCACATAGAGTGAATTTGCTCTGAAGAACAATGATAATGGCTTAGCCAATGCGCTCGTTTCTTCTTTTTTCCTGCAGAATGTAATTGCTCTGACTGTAGACTGGTGAGACATTAGCAGAAGTGCCTTTTCTAATACCACTTCAATTCCTAGAAGCTCATGAAAGATGGAAAGGCCGTGGCACAGTCTTACATTCAAGCTGAAGAACTCTTCGGGGTGCTTTTAGTTAAATCTCTCTTATGACCCCTCTTCTAGGTGAGAGTTATATTCTTAAGTTCAGATCCAACCACACTCAGAGTACTCGGATAAAGCTCACTTGGGAGCGATATCGACCGCCAGACTACAGAGACCTCATCAGCTTCATTGTGTATTA[C/A]AAGGAGGCGTAAGTACCAGTTACTATTGTAAACCTATTTTTCACTTCCAGCTGGGATGGAGCGTTATATAAATGTATGTTTGTGTGTTGTTGTCTTGATGAAGACCATTCCAGAACATCACTGAATTCGATGGACAGGATGGGTGTGGCTCTAATAGCTGGAACATGGTGGATGTGGACCTTCCTCAGGAAAAATCGATAGATCCTGGAGTACTGCTGTCCCCCCTTAAACCCTGGACTCAGTATGCCATCTTTGTGAAGGCCGTCACTCTGGTTGTAGAGGACAAGCATGTTGGGGGAGCTAAGAGTGAGGTGGTCTACATCCGCACCAATGCATCAGGTTGGTTACACACTAGTTTCAAATACATTGAATTGCTCATTTGAGAATGCATTTTGAATTATTATTTGATCATTTGAGCGTTTGATTTATCACTTGGGTAGTTGTTTTGAAAGTTCAATTTATTATTTGATCTTTTTTGGCATTTTTCATTTTCATTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9079
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010189 Essential Splice Site 527 1405 7 21

The following transcripts of ENSDARG00000027423 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 20695332)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20925555
GRCz11 18 20914621
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCGYCAGACTACAGAGACCTCATCAGCTTCATTGTGTATTACAAGGAGGC[G/A]TAAGTACCAGTTACTATTGTAAACCTATTTTTCAYTWCCAGCTGGGATGG
Long Flanking Sequence:
GAGTTGGTTGGTAGACGGCAGCGTTATCTCATTACTCAAGCCTTTTAAAATGCAGTTTGCTCCTCAGGTGTCCCGGTAGTCCTTCGCTATCTGCTTCCCTATTATGCCTTTGACAGATTTCCACATAGAGTGAATTTGCTCTGAAGAACAATGATAATGGCTTAGCCAATGCGCTCGTTTCTTCTTTTTTCCTGCAGAATGTAATTGCTCTGACTGTAGACTGGTGAGACATTAGCAGAAGTGCCTTTTCTAATACCACTTCAATTCCTAGAAGCTCATGAAAGATGGAAAGGCCGTGGCACAGTCTTACATTCAAGCTGAAGAACTCTTCGGGGTGCTTTTAGTTAAATCTCTCTTATGACCCCTCTTCTAGGTGAGAGTTATATTCTTAAGTTCAGATCCAACCACACTCAGAGTACTCGGATAAAGCTCACTTGGGAGCGATATCGACCGCCAGACTACAGAGACCTCATCAGCTTCATTGTGTATTACAAGGAGGC[G/A]TAAGTACCAGTTACTATTGTAAACCTATTTTTCACTTCCAGCTGGGATGGAGCGTTATATAAATGTATGTTTGTGTGTTGTTGTCTTGATGAAGACCATTCCAGAACATCACTGAATTCGATGGACAGGATGGGTGTGGCTCTAATAGCTGGAACATGGTGGATGTGGACCTTCCTCAGGAAAAATCGATAGATCCTGGAGTACTGCTGTCCCCCCTTAAACCCTGGACTCAGTATGCCATCTTTGTGAAGGCCGTCACTCTGGTTGTAGAGGACAAGCATGTTGGGGGAGCTAAGAGTGAGGTGGTCTACATCCGCACCAATGCATCAGGTTGGTTACACACTAGTTTCAAATACATTGAATTGCTCATTTGAGAATGCATTTTGAATTATTATTTGATCATTTGAGCGTTTGATTTATCACTTGGGTAGTTGTTTTGAAAGTTCAATTTATTATTTGATCTTTTTTGGCATTTTTCATTTTCATTTTGTTAGAGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36639
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010189 Nonsense 1201 1405 20 21

The following transcripts of ENSDARG00000027423 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 20672631)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20902854
GRCz11 18 20891920
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTGTATCACCTTGTTCCTCTTTTTGCAGGTCGTTTGGTGTGGTTTTAT[G/A]GGAGATCGCCACATTAGCCGAACAGCCCTACCAGGGCATGTCCAACGAGC
Long Flanking Sequence:
CTCAGATCTCCGGCCAATGTCGAAAATTTGTCCTCCGAGAGCTAATGAATAACGACTGGCAACAGTGCGGTCTTTGTGTGCTTTTTATTTGGGGTTTGCCGAATTTCTGCTCCGCCGCTGCACTTTCTCACCGGCCGCCGGCTAATATATGGACTCGTTTTCATTAATGAGGAACACAGGGCTAACAAAAACACCACACTAAAAGAGAAAAGTTCAGGTCAGCGGCTCATGCGGCGTTTGCGTTGTTTTAGAAAATGAGCATTTTGTTGTTCCAGGCTAGAAAAAACACAAGGATGCATTCGCAGCACTTTTAGTATCGCCCACGGTTAGGCTCTGCAATTGTCTATTGGTGCATCTCTTGACCTCAAATGGCCTCATTTCTTCTTCCTTGTCCTCGTTATTTGATATGTGCAGTTGCTGGATAAATTTAGTATAATTTACTCTAAATGCATTTGTATCACCTTGTTCCTCTTTTTGCAGGTCGTTTGGTGTGGTTTTAT[G/A]GGAGATCGCCACATTAGCCGAACAGCCCTACCAGGGCATGTCCAACGAGCAGGTACTGCGCTTCGTCATGGAGGGAGGACTTCTGGATAAACCGGACAACTGCCCCGACATGCTGTGAGTCCACCAACTGCACGTTGCTCCCAAATTTGGCAGACTGCATTACAATGTTAACCCTTTGTCCTCTAGCTGACTCTTGTCCATGTAGGGTTTGCGATATCCAGTTAAAATGTTGATAGTATGTCAGCAGATGCTGCCACTAACGTCAGACCAAGCGAAAGCCTGACTGGTGTCATTTGCGTCACGGGTTAAAATGAGATGAGTTACATCATGTTGTCAGGGAGCCTCCCACCCATAGAAGAGAGAATGTTTGCTTCCCAAGGGGCTGACTGTCAGAGTGACCCAGACTCCTCTTGTGTTACTTAAGCAAGATACTGCAGACCAAAACTATTTAGACATTTTGAACTTTTCATAGTTATTTATTTCATAGTTATTCAACTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29026
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010189 Nonsense 1209 1405 20 21

The following transcripts of ENSDARG00000027423 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 20672608)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20902831
GRCz11 18 20891897
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGCAGGTCGTTTGGTGTGGTTTTATGGGAGATCGCCACATTAGCCGAA[C/T]AGCCCTACCAGGGCATGTCCAACGAGCAGGTACTGCGCTTCGTCATGGAG
Long Flanking Sequence:
AAATTTGTCCTCCGAGAGCTAATGAATAACGACTGGCAACAGTGCGGTCTTTGTGTGCTTTTTATTTGGGGTTTGCCGAATTTCTGCTCCGCCGCTGCACTTTCTCACCGGCCGCCGGCTAATATATGGACTCGTTTTCATTAATGAGGAACACAGGGCTAACAAAAACACCACACTAAAAGAGAAAAGTTCAGGTCAGCGGCTCATGCGGCGTTTGCGTTGTTTTAGAAAATGAGCATTTTGTTGTTCCAGGCTAGAAAAAACACAAGGATGCATTCGCAGCACTTTTAGTATCGCCCACGGTTAGGCTCTGCAATTGTCTATTGGTGCATCTCTTGACCTCAAATGGCCTCATTTCTTCTTCCTTGTCCTCGTTATTTGATATGTGCAGTTGCTGGATAAATTTAGTATAATTTACTCTAAATGCATTTGTATCACCTTGTTCCTCTTTTTGCAGGTCGTTTGGTGTGGTTTTATGGGAGATCGCCACATTAGCCGAA[C/T]AGCCCTACCAGGGCATGTCCAACGAGCAGGTACTGCGCTTCGTCATGGAGGGAGGACTTCTGGATAAACCGGACAACTGCCCCGACATGCTGTGAGTCCACCAACTGCACGTTGCTCCCAAATTTGGCAGACTGCATTACAATGTTAACCCTTTGTCCTCTAGCTGACTCTTGTCCATGTAGGGTTTGCGATATCCAGTTAAAATGTTGATAGTATGTCAGCAGATGCTGCCACTAACGTCAGACCAAGCGAAAGCCTGACTGGTGTCATTTGCGTCACGGGTTAAAATGAGATGAGTTACATCATGTTGTCAGGGAGCCTCCCACCCATAGAAGAGAGAATGTTTGCTTCCCAAGGGGCTGACTGTCAGAGTGACCCAGACTCCTCTTGTGTTACTTAAGCAAGATACTGCAGACCAAAACTATTTAGACATTTTGAACTTTTCATAGTTATTTATTTCATAGTTATTCAACTTTTGAAGTCTTATTTTAGTTTGATAG
Associated Phenotype:
Not determined