Busch Lab

ZMP

trappc4

Ensembl ID:
ENSDARG00000027418
ZFIN ID:
ZDB-GENE-040426-1734
Description:
trafficking protein particle complex 4 [Source:RefSeq peptide;Acc:NP_957058]
Human Orthologue:
TRAPPC4
Human Description:
trafficking protein particle complex 4 [Source:HGNC Symbol;Acc:19943]
Mouse Orthologue:
Trappc4
Mouse Description:
trafficking protein particle complex 4 Gene [Source:MGI Symbol;Acc:MGI:1926211]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa32015 Nonsense Available for shipment Available now
sa45531 Nonsense Mutation detected in F1 DNA Not yet available
sa10743 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32015
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033411 Nonsense 22 219 1 5
Genomic Location (Zv9):
Chromosome 15 (position 9463019)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9345781
GRCz11 15 9321852
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTATGTTGTCAATAAAGCTGGTGGACTTATTTACCAGTACGATAATTA[T/A]GTACCTCGAGCTGAAGTGGAAAAAACATTTAGCTTTCCGCTCGATTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45531
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033411 Nonsense 85 219 2 5
ENSDART00000033411 Nonsense 85 219 2 5
Genomic Location (Zv9):
Chromosome 15 (position 9462736)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAGACGTGAATGGTAAATTCACTGCGGAAGGGAAGGAGATTCAGGAGTA[T/A]CTGAGAGATCCTGCAAACTATCCAGTGTCCATCAGATTCGGCAGACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10743
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033411 Nonsense 85 219 2 5
ENSDART00000033411 Nonsense 85 219 2 5
Genomic Location (Zv9):
Chromosome 15 (position 9462736)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9345498
GRCz11 15 9321569
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTAGACGTGAATGGTAAATTCACTGCGGAAGGGAAGGAGATYCAGGAGTA[T/G]CTGAGAGATCCTGCAAACTATCCAGTGTCCATCAGATTCGGCAGAYAGAR
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1925
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033411 Nonsense 101 219 2 5
Genomic Location (Zv9):
Chromosome 15 (position 9462690)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9345452
GRCz11 15 9321523
KASP Assay ID:
554-1914.1 (used for ordering genotyping assays)
KASP Sequence:
AGTATCTGAGAGATCCTGCAAACTATCCAGTGTCCATCAGATTCGGCAGA[C/T]AGAGACTCTCTTCAAACGAGAAGCTCATGCTGGCCTCAATGTTTCACTCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4591
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033411 Nonsense 200 219 5 5
ENSDART00000033411 Nonsense 200 219 5 5
Genomic Location (Zv9):
Chromosome 15 (position 9457437)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9340199
GRCz11 15 9316270
KASP Assay ID:
2261-7172.1 (used for ordering genotyping assays)
KASP Sequence:
TATAACAAAAAAANNCAATGCTTAATTKTCTTTCAGATGTGAACTRTTTGAC[C/T]AAAACCTAAAGAGTGCCCTGGAAATAGCAGAGAAAGCAGGGACGTTTGGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19103
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033411 Nonsense 200 219 5 5
ENSDART00000033411 Nonsense 200 219 5 5
Genomic Location (Zv9):
Chromosome 15 (position 9457437)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9340199
GRCz11 15 9316270
KASP Assay ID:
2261-7172.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATAACAAAAAAACAATGCTTAATTTTCTTTCAGATGTGAACTATTTGAC[C/T]AAAACCTAAAGAGTGCCCTGGAAATAGCAGAGAAAGCAGGGACGTTTGGA
Associated Phenotype:
Not determined