Busch Lab

ZMP

zgc:73347

Ensembl ID:
ENSDARG00000027316
ZFIN ID:
ZDB-GENE-040426-1956
Description:
T-complex protein 11-like protein 2 [Source:RefSeq peptide;Acc:NP_998185]
Human Orthologue:
TCP11L2
Human Description:
t-complex 11 (mouse)-like 2 [Source:HGNC Symbol;Acc:28627]
Mouse Orthologue:
Tcp11l2
Mouse Description:
t-complex 11 (mouse) like 2 Gene [Source:MGI Symbol;Acc:MGI:2444679]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26270
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034441 Nonsense 317 529 7 10
Genomic Location (Zv9):
Chromosome 4 (position 15804998)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16747838
GRCz11 4 16736814
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAGGGCCCTCACTGGTGCTAAACACTGCCTACATCAAACTGCTGACCT[G/A]GGACGACAGCAAAGGCCCATTGCCTGAGGTGAGTCCATACTTTGCGCCTA
Associated Phenotype:
Not determined