Busch Lab

ZMP

si:ch211-130o18.2

Ensembl ID:
ENSDARG00000027192
ZFIN ID:
ZDB-GENE-060503-193
Description:
Novel protein similar to vertebrate hyperpolarization activated cyclic nucleotide-gated potassium ch
Human Orthologue:
HCN3
Human Description:
hyperpolarization activated cyclic nucleotide-gated potassium channel 3 [Source:HGNC Symbol;Acc:1918
Mouse Orthologue:
Hcn3
Mouse Description:
hyperpolarization-activated, cyclic nucleotide-gated K+ 3 Gene [Source:MGI Symbol;Acc:MGI:1298211]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa25085 Nonsense Mutation detected in F1 DNA Not yet available
sa6545 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25085
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039325 Nonsense 247 639 2 7
Genomic Location (Zv9):
Chromosome 19 (position 9822878)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9281417
GRCz11 19 9200342
KASP Assay ID:
554-7763.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAATCATCCTAGACCCGCAAATCATCAGCCGGCGTTACCTGCGAGGATG[G/A]TTCCTGGTGGACTTCATCTCCTCCATACCAGTGGACTACATCTTCCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6545
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039325 Essential Splice Site 439 639 4 7
Genomic Location (Zv9):
Chromosome 19 (position 9827634)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9286173
GRCz11 19 9205098
KASP Assay ID:
554-5427.1 (used for ordering genotyping assays)
KASP Sequence:
CCAACCTGGTCCAGTCTTTRGATGCTTCCCATCGTCAGTACCAAGAAAAG[G/A]TACAAGCTRATAAGTTAAGSCTTTTTGAGACATCGTTTTCTTCTTTTGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4063
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039325 Nonsense 464 639 5 7
Genomic Location (Zv9):
Chromosome 19 (position 9827787)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9286326
GRCz11 19 9205251
KASP Assay ID:
2261-2963.1 (used for ordering genotyping assays)
KASP Sequence:
TCCTTCCACAAGCTGCCAGCTGACATGAGGCAGCGGATCCATGATTATTA[T/G]GAGCACCGCTTTCAGGGCAAGATGTTCGATGAGGAGAATATCCTGGAAGA
Associated Phenotype:
Not determined