Busch Lab

ZMP

si:dkeyp-122e7.1

Ensembl ID:
ENSDARG00000027079
ZFIN ID:
ZDB-GENE-070912-632
Description:
zinc finger protein 804A [Source:RefSeq peptide;Acc:NP_001116173]
Human Orthologue:
ZNF804A
Human Description:
zinc finger protein 804A [Source:HGNC Symbol;Acc:21711]
Mouse Orthologue:
Zfp804a
Mouse Description:
zinc finger protein 804A Gene [Source:MGI Symbol;Acc:MGI:2442949]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa13452 Nonsense Available for shipment Available now
sa21441 Nonsense Available for shipment Available now
sa21440 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13452
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038651 Nonsense 4 1132 1 4
Genomic Location (Zv9):
Chromosome 9 (position 12310407)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12062972
GRCz11 9 12034175
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTCTCTCTCGGCTAGTGCATGGAAGCTTCGGGTCCCCCATGGCGTGTYA[T/G]TATATTGTCATCAGCTCCACGCATCTCAGCAATGGACACTTTCGAAAYAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21441
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038651 Nonsense 78 1132 2 4
Genomic Location (Zv9):
Chromosome 9 (position 12199109)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11951674
GRCz11 9 11922877
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTGACAAACAGTATTACAAGCATCAAGAGTTTGACAACCACATCAACT[C/A]GTATGACCACGCTCACAAGCAGGTAATGGGCCTGTTGTCTGCCCCTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21440
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038651 Nonsense 593 1132 4 4
Genomic Location (Zv9):
Chromosome 9 (position 12184624)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11937189
GRCz11 9 11908392
KASP Assay ID:
2260-1560.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGACACTGGGAGACAGAGAGCAGTATGGTGAAATCTAAGAAATTCCTC[A/T]GACGACCTGAGTGTGTGAAAGGACTTGATAGCCAATTTAGAGGCACCACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3743
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038651 Nonsense 930 1132 4 4
Genomic Location (Zv9):
Chromosome 9 (position 12183613)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11936178
GRCz11 9 11907381
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTCAGCRGCTGCTCAGGCCTGCCTGCTGGATGTGAGAGAGTTAGCCCTG[C/T]AGAGGACTGAAAAAGCCACCCAAGACAAATCATGTCAGCATAGCCTTCAA
Associated Phenotype:
Not determined