Busch Lab

ZMP

si:dkey-183c23.1

Ensembl ID:
ENSDARG00000027016
ZFIN ID:
ZDB-GENE-081107-54
Description:
Novel protein similar to vertebrate golgi-specific brefeldin A resistance factor 1 (GBF1) [Source:Un
Human Orthologue:
GBF1
Human Description:
golgi brefeldin A resistant guanine nucleotide exchange factor 1 [Source:HGNC Symbol;Acc:4181]
Mouse Orthologue:
Gbf1
Mouse Description:
golgi-specific brefeldin A-resistance factor 1 Gene [Source:MGI Symbol;Acc:MGI:1861607]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa12707 Nonsense Available for shipment Available now
sa18494 Nonsense Available for shipment Available now
sa9693 Nonsense Available for shipment Available now
sa14258 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12707
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046792 Nonsense 154 1786 5 38
ENSDART00000141695 Nonsense 206 601 8 15
ENSDART00000146592 None None 1177 None 24
Genomic Location (Zv9):
Chromosome 13 (position 6555601)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7348759
GRCz11 13 7680961
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACGTGTGTCTCTGCAGATTGCCACAGTTCAAAGAGGAGGCCAAGAGTTA[T/A]GTGGGCACTAACATGAAGAAGGTAAATATRAAATCCTTTTTGCTATCCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2729
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046792 Essential Splice Site 642 1786 15 38
ENSDART00000141695 None None 601 None 15
ENSDART00000146592 Essential Splice Site 31 1177 2 24
Genomic Location (Zv9):
Chromosome 13 (position 6538163)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7366197
GRCz11 13 7698399
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAATGGAATAACATTGGTTTATTAATTATTTTTATTAATTGTACTCCRAA[G/T]CTTCTGATCACGGGTACAGAACAGTTCAATCAGAAGCCAAAGAAAGGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18494
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046792 Nonsense 740 1786 16 38
ENSDART00000141695 None None 601 None 15
ENSDART00000146592 Nonsense 129 1177 3 24
Genomic Location (Zv9):
Chromosome 13 (position 6533905)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7370455
GRCz11 13 7702657
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTTGTATCTGGAGGCTTTCCGTCTTCCTGGCGAAGCGCCTGTCATTCAT[C/T]GACTTTTGGAAACCTTCACYGACAACTGGCATGTAAGTCAGCTGCCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9693
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046792 Nonsense 768 1786 17 38
ENSDART00000141695 None None 601 None 15
ENSDART00000146592 Nonsense 157 1177 4 24
Genomic Location (Zv9):
Chromosome 13 (position 6533107)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7371253
GRCz11 13 7703455
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGAACGGTAATCCCTTCCAGACAAATGACGCTGGCTTCGCCCTGGCTTA[C/A]GCCGTGATCATGYTWAACACCGATCAGCACAACCATAACGTTCGAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14258
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046792 Essential Splice Site 820 1786 18 38
ENSDART00000141695 None None 601 None 15
ENSDART00000146592 Essential Splice Site 209 1177 5 24
Genomic Location (Zv9):
Chromosome 13 (position 6528945)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7375415
GRCz11 13 7707617
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAATGACTTTGATCAAGATATGCTGGAAGACATCTACAATGCCATCAAG[T/C]TAGTGCTCATTGTCTTGTTGTTCTCTTGCAGTTGTTGCTCTTTCTAATRC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28060
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046792 Nonsense 901 1786 20 38
ENSDART00000141695 None None 601 None 15
ENSDART00000146592 Nonsense 290 1177 7 24
Genomic Location (Zv9):
Chromosome 13 (position 6518112)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7386248
GRCz11 13 7718450
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTAATCAAGATTATAATGTTGATGCTCTTCTTTTGCTTTCAGGAAATG[T/A]GCCATGATCTCTGCACACTACGGCTTCAGTGACGTCTTTGATAACTTGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28059
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046792 Splice Site None 1786 None 38
ENSDART00000141695 None None 601 None 15
ENSDART00000146592 Nonsense 1101 1177 23 24
Genomic Location (Zv9):
Chromosome 13 (position 6491838)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7412522
GRCz11 13 7744724
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGACCCTCATCGCCTCAAGACATGCCGACACCGAGTGCCAACGGTGAT[C/T]GTAAGCTTTTTTTTTTTTTTAAACATTCTTTGAATTGGAGTGGGTGCTAT
Associated Phenotype:
Not determined