Busch Lab

ZMP

ccdc75

Ensembl ID:
ENSDARG00000026892
ZFIN ID:
ZDB-GENE-040718-89
Description:
Coiled-coil domain-containing protein 75 [Source:UniProtKB/Swiss-Prot;Acc:Q6DGZ0]
Human Orthologue:
CCDC75
Human Description:
coiled-coil domain containing 75 [Source:HGNC Symbol;Acc:26768]
Mouse Orthologue:
Ccdc75
Mouse Description:
coiled-coil domain containing 75 Gene [Source:MGI Symbol;Acc:MGI:1858435]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa42309 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa28210 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10202 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42309
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034541 Essential Splice Site 17 262 1 8
Genomic Location (Zv9):
Chromosome 13 (position 51223159)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49934256
GRCz11 13 50247499
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCTGATGATGAAGATGATTACATGTCTGACGCTTTCCTCAACCAAATG[T/C]GAGTTTAAGAATTGACGTTTTTAGCGTCATACTTGTACAGTCAGAGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28210
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034541 Essential Splice Site 107 262 3 8
Genomic Location (Zv9):
Chromosome 13 (position 51220182)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49931279
GRCz11 13 50244522
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGCAGGTGCTGGACGGGTCGAGCCGGTTCCTCTCAACATCAAAACAGG[T/G]CAGGAATATTCTGATTTTCGCATTATTAGTTATTTATGACATTGAGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10202
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034541 Nonsense 252 262 8 8
Genomic Location (Zv9):
Chromosome 13 (position 51212129)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49923226
GRCz11 13 50236469
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCACTGACATTTTCYCATTCAACAGATGAAGAGGATTTGGGTACRAATTG[T/A]CCTGGAGACACGGCAGCGGATCATGATGATWRAAACAACACAAATGCTTT
Associated Phenotype:
Not determined