Busch Lab

ZMP

si:dkeyp-24h9.1

Ensembl ID:
ENSDARG00000026804
ZFIN IDs:
ZDB-GENE-061013-24, ZDB-GENE-061013-24, ZDB-GENE-081107-75
Description:
Coiled-coil domain-containing protein 109A [Source:UniProtKB/Swiss-Prot;Acc:Q08BI9]
Human Orthologue:
CCDC109A
Human Description:
coiled-coil domain containing 109A [Source:HGNC Symbol;Acc:23526]
Mouse Orthologue:
Ccdc109a
Mouse Description:
coiled-coil domain containing 109A Gene [Source:MGI Symbol;Acc:MGI:3026965]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa22206 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22206
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058621 Nonsense 353 376 9 9
ENSDART00000130884 Nonsense 353 376 9 9
ENSDART00000135832 None None 39 None 1
Genomic Location (Zv9):
Chromosome 13 (position 4377098)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4593827
GRCz11 13 4722413
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTTATTATGTTTAATTGTCTTCTTTCTCATCTCTACCTCAGGCGGAGT[T/A]GGATCTAAAGCGTCTACGAGACCCGCTGCAGTTGAATCTCCCTATCCAGC
Associated Phenotype:
Not determined