Busch Lab

ZMP

stau2

Ensembl ID:
ENSDARG00000026801
ZFIN ID:
ZDB-GENE-040426-687
Description:
Double-stranded RNA-binding protein Staufen homolog 2 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZW47]
Mouse Orthologue:
Stau2
Mouse Description:
staufen (RNA binding protein) homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1352508]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa113 Nonsense Confirmed mutation in F2 line Not yet available
sa24458 Nonsense Available for shipment Available now
sa44106 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa113
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028832 Nonsense 209 653 6 15
ENSDART00000122903 Nonsense 234 678 5 14
ENSDART00000142457 Nonsense 234 678 6 15

The following transcripts of ENSDARG00000026801 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 12980373)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12931821
GRCz11 24 13076240
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTTTACGTGCAGCTGACAGTGGGGAACAACGAGTTTATCGGAGAGGGA[C/T]GAACTCGCCAAGCTGCCCGACACAATGCAGCCATGAAAGCCCTCCAGGCC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa24458
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028832 Nonsense 384 653 9 15
ENSDART00000122903 Nonsense 409 678 8 14
ENSDART00000142457 Nonsense 409 678 9 15

The following transcripts of ENSDARG00000026801 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 13009335)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12960783
GRCz11 24 13105202
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGAAGGAGCCTGAATACATGCTGCTTTCAGAGAGAGGGATGCCTCGT[C/T]GAAGAGAATTCATCATGCAGGTAAGATTAATAAGAAAGCGAATCAAAAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3271
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028832 Nonsense 466 653 12 15
ENSDART00000122903 Nonsense 491 678 11 14
ENSDART00000142457 Nonsense 491 678 12 15

The following transcripts of ENSDARG00000026801 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 13042037)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12993485
GRCz11 24 13137904
KASP Assay ID:
554-3115.1 (used for ordering genotyping assays)
KASP Sequence:
TTTTTTATTGTAGCACAAAAAGGAATTCTTCACCTTTCCCCGGACGTGTA[T/G]CAAGAAATGGAAGCAAGTCGCAACAAAGGAGTCCCCGGTGCTCCTGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44106
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028832 Essential Splice Site 555 653 12 15
ENSDART00000122903 Essential Splice Site 580 678 11 14
ENSDART00000142457 Essential Splice Site 580 678 12 15

The following transcripts of ENSDARG00000026801 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 13042305)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12993753
GRCz11 24 13138172
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCAGCCTTCCCAACAGCTGGAGTACTTGGCTCACATTCAAGGTTTCCAG[G/C]TACAGAATAAATGAAGTGATTTTGCATATTTGTTTACCTCTCTCTTTCTC
Associated Phenotype:
Not determined