Busch Lab

ZMP

aqp7

Ensembl ID:
ENSDARG00000026787
ZFIN ID:
ZDB-GENE-030131-6461
Description:
aquaporin-7 [Source:RefSeq peptide;Acc:NP_956204]
Human Orthologue:
AQP7
Human Description:
aquaporin 7 [Source:HGNC Symbol;Acc:640]
Mouse Orthologue:
Aqp7
Mouse Description:
aquaporin 7 Gene [Source:MGI Symbol;Acc:MGI:1314647]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa23873 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23873
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032586 None None 294 1 6
ENSDART00000123522 Nonsense 8 336 1 6
Genomic Location (Zv9):
Chromosome 21 (position 10434537)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11917900
GRCz11 21 12010528
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAGCCATGGCTGACAAAACACAATAGTTCAATTCACACCAGTGCAACTA[T/A]TCAAAGAGTCTGAATGATCAAGCTGGGAGAGAAGAGTCTAGTGCAGAAAA
Long Flanking Sequence:
GTGTGTGTGTGTGTTTATTTTTCACCACTAATCCTCCATTCTTCAATACAAATCAGCAAGAGATAAGCTATCTTTTCAACAAGCACAAACATCAGGTGTATATGCTTTGTGGGAACGTACAGAGTACAAAGAACAGTACAAGCCTGATTAATTACTTATTTAATTATTTGATTATTCATTAATCAAATCCAAAACAAAATGTTTCCTAGAAAAACTGCATGTGTAAAATCAAAGTTACACTTAAAAAGCAAGCGAATAATAATTAATGCTTACTGTCAAGTTCACATACATATGAAATAGTGCTTATCTTATCTGTAATGGATACTGATGGAGCATTTGAAAGTTTGACCAACTCGTGATACTGCAGTGTGTTTCCTGTTGCCTCTGAAAATCACATGTTACTTAGGGGCACATGTGTGTGTAAAGGGGAGGTGCAAAGTCTTCATATAAATAGCCATGGCTGACAAAACACAATAGTTCAATTCACACCAGTGCAACTA[T/A]TCAAAGAGTCTGAATGATCAAGCTGGGAGAGAAGAGTCTAGTGCAGAAAAGGAAGTGAAACAGGAAGTCAGCATAATGGAAGATGGCAGCATTCAAGGCCGCATGGCTCCAAATGTTGGATCCATGTTGAAGATCAAGAATGAATACATTCGAGTGGCTTTGGCAGAAAGCCTCTGCACATTCATCATGATGGTAAGAGCTTGTTTCTTTTGTATGAATTCACTGTTATTTAATAGAGGCTAATTTACTGGCAATGCATTGCTGGTTTAAAACTGAATGAGTGTTTTACTGATGATTTGTTCTATTGTCGCTGTTCATTCATTCATGTTGTTTTCAGAAGATGATTGAGTGCTTGTCATTGTTTTGTTGTGTATAATATGGCCACAGCTTGCAGGATGAGACTGAATGGGTCAGACCATGTGCTATAAGTGCTATTTTTAGAAAGATTTGCTTGACATACTGCCAAATTCTAAAACATTGTTTCTGTCACTGACTACCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29539
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032586 Nonsense 117 294 3 6
ENSDART00000123522 Nonsense 159 336 3 6
Genomic Location (Zv9):
Chromosome 21 (position 10438813)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11922176
GRCz11 21 12014804
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCAGTTTCTGGGTTCATTCCTTGCCGCCGGGACCATTTTTTCACTTTA[T/G]TATGGTGAGTAAATACTAAGTTTGTTTTAAATGTTGGAGTAGGTCAAACA
Long Flanking Sequence:
ACTTCAATTGGAGAAAGTATAACAACCAAAATGATGAATATGCTTCACCTCCTTAATTTAAAAAGCCAATCATTCATTAGTAAAGTCACTGCGGCTGCCATTTTGAAACTGGCTGCTATATAAACAGGCAACATACTCAGATTCGCACTCATGACTGAAAAAAATGAGCTTTTTGATGCTATTTAAACTCTGTTGTCACTGAATTTAACTTGTTTTGAAATATGAAATTTATCTGTAAGCTTTGTGGGCCGTACAGAACTTGCTGTATTCAAAGAGATGCATTTGGATGTTAGAGAAATGTTTCAAAGATGGCCGCCGAGTGAATTGACTCACTTTAAGTGGACTTTTTTTTCACTCAACAACACAGGAGCTCATATGAACGCAGCTGTTTCATTCACAATGTGCGTGTTTGGCCGATTGCGCTGGAAGATGCTGCCGCTGTATGTTTTCGCTCAGTTTCTGGGTTCATTCCTTGCCGCCGGGACCATTTTTTCACTTTA[T/G]TATGGTGAGTAAATACTAAGTTTGTTTTAAATGTTGGAGTAGGTCAAACAAATTGGCACAAGGTTTCTTTGCTAGCATTTGTTCTGCTTTTTATAGATGCCATAAATCATTTCTGCGGGGGTAATTTGACTGTGTCCGGACCCAAAGCAACAGCTGGGATCTTCGCCACATATCCAGCACCCTATATCTCAGTCTACACTGGATTCTTTGATCAGGTATTTCTGAATGAATATAAATGCAGTGAAAACAGTGGTTTGGTCATTTATGGTTTGTTTTTTCAGTACAGCAGGGGGGAAAATAAATGCACATTCCCTTTTTTTGTCCTTTTTTATTTTGTAAATCAGTTACTAAGTATTATGTTTCTCTGTCTGTAAATTAAATACATTTAAATATCAGTTAATACCATCAACTATAAGGAAGCCAGGCTAGGCTACAAATAAAGACAAAACTGTAAAAAATTAATGATTAAAAAGTCAAGTTTAATGTTGTAGTTGAAACCC
Associated Phenotype:
Not determined