Busch Lab

ZMP

zgc:109901

Ensembl ID:
ENSDARG00000026767
ZFIN ID:
ZDB-GENE-030131-419
Description:
Nucleolar protein 11-like [Source:UniProtKB/Swiss-Prot;Acc:Q4V9P9]
Human Orthologue:
NOL11
Human Description:
nucleolar protein 11 [Source:HGNC Symbol;Acc:24557]
Mouse Orthologue:
Nol11
Mouse Description:
nucleolar protein 11 Gene [Source:MGI Symbol;Acc:MGI:1916229]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa17711 Nonsense Available for shipment Available now
sa30872 Nonsense Mutation detected in F1 DNA Not yet available
sa40674 Nonsense Mutation detected in F1 DNA Not yet available
sa33853 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33852 Nonsense Mutation detected in F1 DNA Not yet available
sa26731 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17711
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037709 Nonsense 80 708 2 18
Genomic Location (Zv9):
Chromosome 6 (position 21587637)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17903411
GRCz11 6 23001330
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGACAGTTGATCACCTGYCCCGCTGTGTATAACACAAAGTCCCAGGAATA[T/A]GTGGYTGTTACAGATAATAAGGTAAGGTGATATAATATTTTATATTATAA
Long Flanking Sequence:
CGAAGAAGAAGTAATTGTCTCATCTCGCGATAGAAACAACTCGAGGGTAGAAGAAACATGGCAACGCTGTATGAGGAATACACGCTGTGTGGAGTTGGACCAGACAAGAATTCGTCCAGTTCAGGAGTTCTGGGGATTGAATTGGGAAAAGATGTTGACCACATAATTGTCACTCACTCTTCGAGAGCAGTTACAGTTTACAAGGTAAATGAGTAACAAAAATGATTGCACGCGGTGATGGGAAAATTCCAGCGTGTAAGCTAACGTTATATTGACCAAACACAAACAAGTGCATTGCTTTATTATTTGGAATCTAATGCTAATTTTTAACTATATAAAACATGTTTAGTTGGAGATTTAGTAGTTGTTTGTGTAATTGCGTAATTTCATAAGTGTTTTGATGATTAGGTGTCTGATCAGAAGCCCACGGGCAGTTGGACAGTGAAACAGGGACAGTTGATCACCTGCCCCGCTGTGTATAACACAAAGTCCCAGGAATA[T/A]GTGGTTGTTACAGATAATAAGGTAAGGTGATATAATATTTTATATTATAAAGAATAAGAATGCTCCAAGTTCATGTCTTGTAAACTTAAGCATTTTTTTAGGTTATCAGAGTTTGGAAAGAAGACGATGTCAATATGGAGAAGGCGTTTAAAGCCACGGTATGTGGACTAATATTTCATAAGGTTTTATTTGTCAATATATTACACGTTATGTGGTTAAATTTAAGTATTTTTTTCTGGCTTAATCAATTGAAACAGTTTTTCTAGGAATATTTTTGATCGATGTAAACATTACAACCATACAAAATACAAAATCATGAAAACTTGGAGTACAATGCAATAAATAAATAAATAAAAATGGGAGTTTTCAGGTTAGTTCCAGATTCTCTATTAATATATAGTACTGTAAGGCATTTTTTCTTAATTTTAAACGACAAAGTAATAACAAATTTTTGTGAAGCACTTTATAAATTCATTGGTCAAAATGATTTCTCTATAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30872
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037709 Nonsense 125 708 4 18
ENSDART00000037709 Nonsense 125 708 4 18
Genomic Location (Zv9):
Chromosome 6 (position 21584931)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17900705
GRCz11 6 22998624
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTGATGTTCTCAGGGTGATGGCAGCTTCTGACTCTGAACCTGTTGTGT[T/A]GTTTAGTTGTGGGGCTGTCATGTTCTTGGACTCGTTGCTTGCTTCACCAC
Long Flanking Sequence:
TTATTTTCTATTTGATTACCGATGACTGCTTTGCAGCTTTCATTATTGAATTTAATTATTATTTATTATAATCTTTTGTTTGTTTTGTAGCAAAAATATTATTTATTAAATTGACATGCATATAAAAACAATAGTACAGAAATAAATATTATTACTGCAAAGTTTTATTTGTGTTTGATGCAAACCTTAAATGTATTTTTCATAAAGTAATAGTAGGACATTTTATAGCACAAAACTTGCATTCAAGCACATTCAAGGCAGCATGATAATGAGAAATGTAATTCATTGCTAGTATTATTGTCATAATCGTCATCATTAATATTTTATAATTATTAGACTTTCATTTTGGAATCATTTCGAGCCATGAAATGTATTAGGTGAAGCTGATTTTGAAACCATGTTTGGCTTTGTAACCTAAATTGTATTTTTTCCTCACTCGTTTCAGGTTTCATCTGATGTTCTCAGGGTGATGGCAGCTTCTGACTCTGAACCTGTTGTGT[T/A]GTTTAGTTGTGGGGCTGTCATGTTCTTGGACTCGTTGCTTGCTTCACCACAACAACCTATAGAAGGCGTTTTAACAGAGGAAGAGTTCATCAGGTTAGAACATACAAGATTATTTAATTACTTTTGTCCTGAAAACACATTGGTAAACCTATCATTTAATATTGAATTAGCTAAATGCTTTTCTTAAATGTAATGGTCCACAAAAATAATAAAACTTTTGATGGATTTACTGCTCCCTTAGGCAGCCTAAGTCTGCATATGAAATTCACAGCTATTAGCTGAACCATGTAATCGATCTGTTGATGGATCTGCAATTTTGGATTAACACTTTCAGATGGATCAACACTGTCAGAGAGATTTCAAATGGTGTGTCAGTGATGTCATCACACAGGCAGCCAATGGTCTTTTTCACTTTTTGATGGCTCCAAACTGAAAATTTAATTGGCCTGGTTTTAGGCACAGGTTTGTGTTTTTAGTGACACTTATTGTTATTGATGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40674
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037709 Nonsense 125 708 4 18
ENSDART00000037709 Nonsense 125 708 4 18
Genomic Location (Zv9):
Chromosome 6 (position 21584931)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17900705
GRCz11 6 22998624
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTGATGTTCTCAGGGTGATGGCAGCTTCTGACTCTGAACCTGTTGTGT[T/A]GTTTAGTTGTGGGGCTGTCATGTTCTTGGACTCGTTGCTTGCTTCACCAC
Long Flanking Sequence:
TTATTTTCTATTTGATTACCGATGACTGCTTTGCAGCTTTCATTATTGAATTTAATTATTATTTATTATAATCTTTTGTTTGTTTTGTAGCAAAAATATTATTTATTAAATTGACATGCATATAAAAACAATAGTACAGAAATAAATATTATTACTGCAAAGTTTTATTTGTGTTTGATGCAAACCTTAAATGTATTTTTCATAAAGTAATAGTAGGACATTTTATAGCACAAAACTTGCATTCAAGCACATTCAAGGCAGCATGATAATGAGAAATGTAATTCATTGCTAGTATTATTGTCATAATCGTCATCATTAATATTTTATAATTATTAGACTTTCATTTTGGAATCATTTCGAGCCATGAAATGTATTAGGTGAAGCTGATTTTGAAACCATGTTTGGCTTTGTAACCTAAATTGTATTTTTTCCTCACTCGTTTCAGGTTTCATCTGATGTTCTCAGGGTGATGGCAGCTTCTGACTCTGAACCTGTTGTGT[T/A]GTTTAGTTGTGGGGCTGTCATGTTCTTGGACTCGTTGCTTGCTTCACCACAACAACCTATAGAAGGCGTTTTAACAGAGGAAGAGTTCATCAGGTTAGAACATACAAGATTATTTAATTACTTTTGTCCTGAAAACACATTGGTAAACCTATCATTTAATATTGAATTAGCTAAATGCTTTTCTTAAATGTAATGGTCCACAAAAATAATAAAACTTTTGATGGATTTACTGCTCCCTTAGGCAGCCTAAGTCTGCATATGAAATTCACAGCTATTAGCTGAACCATGTAATCGATCTGTTGATGGATCTGCAATTTTGGATTAACACTTTCAGATGGATCAACACTGTCAGAGAGATTTCAAATGGTGTGTCAGTGATGTCATCACACAGGCAGCCAATGGTCTTTTTCACTTTTTGATGGCTCCAAACTGAAAATTTAATTGGCCTGGTTTTAGGCACAGGTTTGTGTTTTTAGTGACACTTATTGTTATTGATGCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8230
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037709 Nonsense 182 708 6 18
Genomic Location (Zv9):
Chromosome 6 (position 21578170)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17893944
GRCz11 6 22991863
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAATCAGTTCTGATAAATTGTGTGTTTCAGAGAGGAGAGCACTACCTGTA[T/A]GCTCAAAGATTTAACCCCAACACTGTTGTGAAGCACAGATTTGAGACTGA
Long Flanking Sequence:
CAACTTCGGGTCATACACAGGCCAAAAATTTTGATAAACTGCTGGACAAGGGCAGGGCTTGTGTGTCTGTGTGTTTTGGGCCAAGGCCGGGCTAGGGCTTAGATTTAAGGGCCTTTCAGGGCTCTACTTGGGAAAATCCAGGAGCCATAGGTATTGATTTTGCATTATCTGTTTACTTGCATTATATGAATCTCAAAGAGCTACAATTGCATCTAAAAAGCTTTTATGTTCTGCTGAAGAAAGTCTAGTACATTTTGTATGACCTCAGCCAGATTTGCATATATTGGTTAACAGTTTCTTTAGATGTAAGATGTTATGTTTTCTGTTCCACAGGTGGAGTACTGTTGTTGGGGCAGAACACCAGCTTGTTTTGTTGTTTTGCACGGAAAAGGTTCTGTCTTTTTAAATCTGCTTATTTTTATTTTCTATCAGTGCATGAAGAGAACCTATGAATCAGTTCTGATAAATTGTGTGTTTCAGAGAGGAGAGCACTACCTGTA[T/A]GCTCAAAGATTTAACCCCAACACTGTTGTGAAGCACAGATTTGAGACTGAACCTGGTCCCTTCGCTCCTATCAGTTTCTCTGCCACATGCAGAGGTAGTAATATACATCTGCAGTACTTGTGTAAGTGTCTTCATCATCTGATTATAATGACCAGGGTTTGAAATTGAAATGACTTTGTTTTTTAGTTTTGCTTTTGCTTTTGCACATTTTATAGAAAATATTTGTCAGTGATGCTCCTGCGTTTTCAGAAATAGGTTTCTTACATGCAGATTAATCTTTTTGACATTGTACAAGTTAACAGTGCCATTTCACAGAGCTCTGCTAAGCCCACTGTATTTTTCAGTTATGTCGTACTAATTATTGCAAAAAATTTGCAAAGTAATATCATTTATTAAGCACATTAATGTCAATATAATCAAAGTTTAATTAAAAAATTTTTTATAGAATACTGGTAAATATTAATTTACCATTTGTTTTGAAAGAACTGAGAGATTACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33853
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037709 Essential Splice Site 291 708 8 18
Genomic Location (Zv9):
Chromosome 6 (position 21572997)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17888771
GRCz11 6 22986690
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATCACCATGGGCTTTTGGTGCGATGATCATTATGATGTTGTCATTTGC[A/T]GATTATCTTTGCATCTGGAACAAACATTTCCAAACTCTTCAGGCTTGTAA
Long Flanking Sequence:
TGTAAGAGTCATGTGTTCCTATTTTTTACTTATTTATTTTTATATAATTGCAGATGTTACAGTAGGCTATTTCATATTATCATTGATCTGCAGCTATAATCAAATCCTGTTTATGACCTTAAGTTAATAATTGATGTATAAGTATGTGTGAATAAAGCGTCTGTTTTTTGAGAAGTGGTTCTCATATGTGAACGCTCCGTACAGCTTTACTTTTACATTTCTTTGAAGCGTCAACTGCAGCTTTCTGTCATACACCACACCTTTCAAAAGGGTACAGTTTTTTCAGTGGATACACAAGCCTGATAAATGTGACCCGTACTGTACTGAACTGTACCACTCTGTGTAAACAATAAAAATAAAAACAAGTATAAAGTAAAAGAAACATCAAAGTAAAAGTTTATTCTCAGAGATTTTCTTAACAACCCTTAGAACAACACCCCTTCCTTTCTTTTATCACCATGGGCTTTTGGTGCGATGATCATTATGATGTTGTCATTTGC[A/T]GATTATCTTTGCATCTGGAACAAACATTTCCAAACTCTTCAGGCTTGTAAAGAATTGGCCGGAACAATCTACAGTCAGGTGTGGTTATTACTTATCACCTTTATTGCTATTCTTATTACACTTCTACAAATCTTGAAATAATCTTAATAATTTATTTGTGAAAAATAAAAAAACATGAGGAGAAAACTTTTTTTTCTGAATACAGATCTGGTGTTATTCTGGAAAGCTGTACATTCCTCATGGGAAGATACTATCAGTAATTTCTTTTGAGTGCCAAAAGTCATCTCTCGCGGCTGCCATGGGAAAACTGAAGCAGACAAATCAAAGTGGTAAAGATTTGAAATTTCATTTGAAATATGAAAAAATCTGTCCTAATCTTTTCTTCAGAATATATAAAATGAGGCCAAAATATTAAAGTAAAAATCCCTTTTTCCTTCTCTTCAGAATACAAATCACACACCCCCTTGTCTTCCTGGACGGCTTTGCCGCACAATGACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33852
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037709 Nonsense 292 708 8 18
Genomic Location (Zv9):
Chromosome 6 (position 21572991)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17888765
GRCz11 6 22986684
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATGGGCTTTTGGTGCGATGATCATTATGATGTTGTCATTTGCAGATTA[T/G]CTTTGCATCTGGAACAAACATTTCCAAACTCTTCAGGCTTGTAAAGAATT
Long Flanking Sequence:
AGTCATGTGTTCCTATTTTTTACTTATTTATTTTTATATAATTGCAGATGTTACAGTAGGCTATTTCATATTATCATTGATCTGCAGCTATAATCAAATCCTGTTTATGACCTTAAGTTAATAATTGATGTATAAGTATGTGTGAATAAAGCGTCTGTTTTTTGAGAAGTGGTTCTCATATGTGAACGCTCCGTACAGCTTTACTTTTACATTTCTTTGAAGCGTCAACTGCAGCTTTCTGTCATACACCACACCTTTCAAAAGGGTACAGTTTTTTCAGTGGATACACAAGCCTGATAAATGTGACCCGTACTGTACTGAACTGTACCACTCTGTGTAAACAATAAAAATAAAAACAAGTATAAAGTAAAAGAAACATCAAAGTAAAAGTTTATTCTCAGAGATTTTCTTAACAACCCTTAGAACAACACCCCTTCCTTTCTTTTATCACCATGGGCTTTTGGTGCGATGATCATTATGATGTTGTCATTTGCAGATTA[T/G]CTTTGCATCTGGAACAAACATTTCCAAACTCTTCAGGCTTGTAAAGAATTGGCCGGAACAATCTACAGTCAGGTGTGGTTATTACTTATCACCTTTATTGCTATTCTTATTACACTTCTACAAATCTTGAAATAATCTTAATAATTTATTTGTGAAAAATAAAAAAACATGAGGAGAAAACTTTTTTTTCTGAATACAGATCTGGTGTTATTCTGGAAAGCTGTACATTCCTCATGGGAAGATACTATCAGTAATTTCTTTTGAGTGCCAAAAGTCATCTCTCGCGGCTGCCATGGGAAAACTGAAGCAGACAAATCAAAGTGGTAAAGATTTGAAATTTCATTTGAAATATGAAAAAATCTGTCCTAATCTTTTCTTCAGAATATATAAAATGAGGCCAAAATATTAAAGTAAAAATCCCTTTTTCCTTCTCTTCAGAATACAAATCACACACCCCCTTGTCTTCCTGGACGGCTTTGCCGCACAATGACATTATAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26731
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037709 Essential Splice Site 512 708 13 18
Genomic Location (Zv9):
Chromosome 6 (position 21566179)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17881953
GRCz11 6 22979872
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGACATTCCTGAAGCTGTTACCTGTGCTTATCTCAAAACCATTTTGAGG[T/C]GAGTCTTCAACTAACTTTTTGTTAACATTTGTTACATTTAAAAATTAAGT
Long Flanking Sequence:
TTGCTGTATATTTTTGTATTTGAAGCGGTATATACCCATAGATTATATTCTTTAATTTGATGACCCAATTTACTTATTTACCAGACTGCTGTGGTAGAGGATGTGCAGTCAGCGGTGGGTGAATTTATTCATCAGACTCCTCAGACTGACCTTCAGCTTGCAGCAGGGAAAGTGACAATGGTGCTAGTGTCAAGATCCCAGACAGATGACAGCTTCTACCCTCAGCGTGCATTTCTACAACTGCTAGACACTCGTTATCTCTGCTACAGGTTTGAATATACAATCAGCTCTGTGGACACATTTGTCTACCAGGTACTCCAATGTAAATCTCTATTCATTCATTTGTTTTGTTTGTTTGTTTTTGGATATGTAGTGTTTGCCCAGAATTGTTGTCTCTGGCCATGGCAAAGAGAGATTTTCAACTCTGTCAGATTGCTTTCCAACTTTTTCCAGACATTCCTGAAGCTGTTACCTGTGCTTATCTCAAAACCATTTTGAGG[T/C]GAGTCTTCAACTAACTTTTTGTTAACATTTGTTACATTTAAAAATTAAGTCACCATAATCCATAGGGGTGTAATGTTCAAAACGAACCAAAAAAAATATGGTTTGTACATAGCAAACCGAGGTTCCCCCTCCCATCTGTTTGTGACGCACTGATTGATTGATTTATTGATTTTTAGTTTACTCAGATCACCTGACTGCAATAAACAGACAGGTGAAGCCAATGTATAAAGTTATTTGCACAAATGTCTTTTAAACAAGTTAAAAAAAAACAACTTTTGTTTGACTATAGTACTCCAGACTCTGAGATGGAGACTCTAACCCTTGACACAGAGAGCTTAATCATCATGAAAGAAATGAGTCAAGCTCAAAGTCAAATGGAGGAAGGTGAGCAGCAGAACGAGAACGGTGTCTCTAGCAGCAAACAACAGAGGGATTTCTTGTCCATGGATATGAAGTGTCCTGTGGGATTACACAAGGGTGTCCTTCTGTATCCTTTGTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26730
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037709 Essential Splice Site 604 708 15 18
Genomic Location (Zv9):
Chromosome 6 (position 21565520)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17881294
GRCz11 6 22979213
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGCCTCTGCTGCAACATCTAAAAGATCTCACAGTTTTGCAGGTCATGG[T/A]GAGTAGATGACAAATGCGTCTTGATTTTTGTCTTTTGTCTTGAATGATTG
Long Flanking Sequence:
TGATTTATTGATTTTTAGTTTACTCAGATCACCTGACTGCAATAAACAGACAGGTGAAGCCAATGTATAAAGTTATTTGCACAAATGTCTTTTAAACAAGTTAAAAAAAAACAACTTTTGTTTGACTATAGTACTCCAGACTCTGAGATGGAGACTCTAACCCTTGACACAGAGAGCTTAATCATCATGAAAGAAATGAGTCAAGCTCAAAGTCAAATGGAGGAAGGTGAGCAGCAGAACGAGAACGGTGTCTCTAGCAGCAAACAACAGAGGGATTTCTTGTCCATGGATATGAAGTGTCCTGTGGGATTACACAAGGGTGTCCTTCTGTATCCTTTGTTTACTTGTTTATAATCAAAGAATGTATGCTGAGTTTCATTTGCTTTTCTGGTCTCTAGTTTTCTTTAACCAGTTAAATAGAAATGATGTTTTGCAGACCGCATACAGTGACAAGCCTCTGCTGCAACATCTAAAAGATCTCACAGTTTTGCAGGTCATGG[T/A]GAGTAGATGACAAATGCGTCTTGATTTTTGTCTTTTGTCTTGAATGATTGTTTGGTGGTAGGTAGTGTTAATTTTTTCCAGCGTACTGTTGCCCACTGTGATAAGGTGTGAGGGTAAAATGTGGAAAGAGAAAAGGGACTGGATTAAAAAGGGCTTCAATTACAATCAAAGACAATTTGCACACTGGCTATAGAACTTTTTCTTTGTTGCTGCTTGGAGGGCGCCATAGTGAACAGCGACTTCCGATAGACTGCTTAGAATTTTGGTTAAGAATTGTCACCAGTCAGAGCAGTGTTTCTCAACTAAATGTCAATACTGTTTTCAGTGGCTTACGGACTGTTTTTGTGATGTAAAACTTTAATTTTGAAAGAAAGTCGTGTGTTAAAGCTGCTATACTTTTGTCAGATGAGGTTCAAGTGCAAGAGAAAAATGTTCTCCTAATTTAGTATCTGCCATTACATCAGATGCTGAAAAATAGCATCAGTGTTCCTGACCTGTCA
Associated Phenotype:
Not determined