Busch Lab

ZMP

grik4

Ensembl ID:
ENSDARG00000026753
ZFIN ID:
ZDB-GENE-070821-5
Human Orthologue:
GRIK4
Human Description:
glutamate receptor, ionotropic, kainate 4 [Source:HGNC Symbol;Acc:4582]
Mouse Orthologue:
Grik4
Mouse Description:
glutamate receptor, ionotropic, kainate 4 Gene [Source:MGI Symbol;Acc:MGI:95817]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa16493 Essential Splice Site Available for shipment Available now
sa16435 Essential Splice Site Available for shipment Available now
sa13014 Nonsense Available for shipment Available now
sa15276 Nonsense Available for shipment Available now
sa16037 Essential Splice Site Available for shipment Available now
sa24983 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13341 Nonsense Available for shipment Available now
sa10219 Nonsense Available for shipment Available now
sa22637 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16493
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035812 Essential Splice Site 83 965 3 19
ENSDART00000035812 Essential Splice Site 83 965 3 19
Genomic Location (Zv9):
Chromosome 15 (position 22298668)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23009855
GRCz11 15 22945120
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCTGTGTCTGTAATAAATGACAGTTGGTCTTTCCCTTATCTATTGACA[G/T]TGTGCCAGATCATGTCCAARGGKGTGGTGGCGGTCCTGGGCCCCTCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16435
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035812 Essential Splice Site 83 965 3 19
ENSDART00000035812 Essential Splice Site 83 965 3 19
Genomic Location (Zv9):
Chromosome 15 (position 22298668)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23009855
GRCz11 15 22945120
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCTGTGTCTGTAATAAATGACAGTTGGTCTTTCCCTTATCTATTGACA[G/T]TGTGCCAGATCATGTCCAARGGKGTGGTGGCGGTCCTGGGCCCCTCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13014
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035812 Nonsense 241 965 6 19
Genomic Location (Zv9):
Chromosome 15 (position 22360484)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23071671
GRCz11 15 23006936
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTCATTTGTCWTCCAGGCCTCAGAGTTGGGGATGCTGTCAGTCTACTA[C/A]ACCTACATCCTGACTTCCTTGGTGAGATGCTGTCTAATGCTGGARTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15276
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035812 Nonsense 287 965 7 19
Genomic Location (Zv9):
Chromosome 15 (position 22408882)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23120069
GRCz11 15 23055334
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTTCAACAGKACACATCCTTTCTTTCAGGACTTTGTGCTCAGCCTCAAT[C/T]GATCCTGGCAGGAGAACTGTGATCACGCACCRTTTGCAGGARCACCGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16037
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035812 Essential Splice Site 353 965 8 19
Genomic Location (Zv9):
Chromosome 15 (position 22414056)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23125243
GRCz11 15 23060508
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTAAGATCTGGGARCAYGGCACGAGTCTGATGAACTACCTGAGGATGG[T/G]AARAATCGCGGGGAAGAGCCCACCAGCTGCCAATCATCTCACCTGCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24983
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035812 Essential Splice Site 424 965 10 19
Genomic Location (Zv9):
Chromosome 15 (position 22460731)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23171918
GRCz11 15 23107183
KASP Assay ID:
554-7788.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTGACGGACACACTATTCAACACCACTCTCACCATAACTACCATTCTGG[T/C]AAGTCCTGTCTTCTACTGCATATTCATGGTCCACATATCCTACCGATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13341
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035812 Nonsense 428 965 11 19
Genomic Location (Zv9):
Chromosome 15 (position 22485095)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23196282
GRCz11 15 23131547
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGTGAGTTAATCTCTGACGCCAGTGCTGTGTTTACAGRAGAACCCGTA[T/A]GTAATGTTGAGAGCCAATCACCAGGAGCTTGAAGGGAACGATCGCTAWGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10219
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035812 Nonsense 444 965 11 19
Genomic Location (Zv9):
Chromosome 15 (position 22485143)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23196330
GRCz11 15 23131595
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATGTAATGTTGAGAGCCAATCACCAGGAGCTTGAAGGGAACGATCGCTA[T/A]GAGGGCTTCTGTGTGGACATGCTAAAGGAGCTGGCGGACATCTTGAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22637
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035812 Essential Splice Site 567 965 13 19
Genomic Location (Zv9):
Chromosome 15 (position 22525622)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23236809
GRCz11 15 23172074
KASP Assay ID:
2260-8448.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTTGCTGGCGTACCTGGCTGTCAGCTGCGTGCTCTTTTTGGTGGCGAG[G/A]TAAATTCTCAGCTCCACACTGACACCTGCAGGATCTTATTAGCACTGACA
Associated Phenotype:
Not determined