Busch Lab

ZMP

clec14a

Ensembl ID:
ENSDARG00000026751
ZFIN ID:
ZDB-GENE-030131-5536
Description:
C-type lectin domain family 14, member A [Source:RefSeq peptide;Acc:NP_956080]
Human Orthologue:
CLEC14A
Human Description:
C-type lectin domain family 14, member A [Source:HGNC Symbol;Acc:19832]
Mouse Orthologue:
Clec14a
Mouse Description:
C-type lectin domain family 14, member a Gene [Source:MGI Symbol;Acc:MGI:1914114]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa42875 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42875
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036567 Nonsense 75 368 1 1
Genomic Location (Zv9):
Chromosome 17 (position 10358784)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 10086540
GRCz11 17 10242574
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCCTAAAAACAATCTGGGACAAGACCAACAGAACGGCTGCTTCATTTTG[G/A]GTTGGACTAAAGAAGGATAAAGGTGTGTGTGTTAAACAAGGATCACCTCT
Associated Phenotype:
Not determined