Busch Lab

ZMP

ftr72

Ensembl ID:
ENSDARG00000026704
ZFIN ID:
ZDB-GENE-041114-86
Description:
Zgc:103602 [Source:UniProtKB/TrEMBL;Acc:Q5U3F5]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa35984 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35984
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099302 Nonsense 472 550 7 7
ENSDART00000139498 None None 175 None 3
Genomic Location (Zv9):
Chromosome 15 (position 40278525)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 41795232
GRCz11 15 41752628
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGATGACTCTAGACTTGGCTACAACAAGCAGTCTTGGAGATTGAGCTG[T/A]TTTAAAGAGAATGTATTTTTTAAACATGACAGTGAAGTAGTCTCAGTCCC
Associated Phenotype:
Not determined