Busch Lab

ZMP

gmds

Ensembl ID:
ENSDARG00000026629
ZFIN ID:
ZDB-GENE-050419-45
Description:
GDP-mannose 4,6 dehydratase isoform 1 [Source:RefSeq peptide;Acc:NP_001095945]
Human Orthologue:
GMDS
Human Description:
GDP-mannose 4,6-dehydratase [Source:HGNC Symbol;Acc:4369]
Mouse Orthologue:
Gmds
Mouse Description:
GDP-mannose 4, 6-dehydratase Gene [Source:MGI Symbol;Acc:MGI:1891112]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa6636 Nonsense Mutation detected in F1 DNA Not yet available
sa6635 Nonsense Mutation detected in F1 DNA Not yet available
sa43452 Nonsense Mutation detected in F1 DNA Not yet available
sa37043 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6636
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046764 Nonsense 4 370 1 11
ENSDART00000103234 Nonsense 4 377 1 12
ENSDART00000143267 Nonsense 4 91 1 3
ENSDART00000146326 Nonsense 4 257 1 8
Genomic Location (Zv9):
Chromosome 20 (position 26852011)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26923314
GRCz11 20 26822404
KASP Assay ID:
554-5317.1 (used for ordering genotyping assays)
KASP Sequence:
CCACAYACACTCGGTCAGAACAGAAACCCGCTCCAGAGAATGGCTCAGTG[T/A]ACAGCAACGACGACTGGTGGCGGTATGAACGGAGACAGCAAGAGGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6635
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046764 Nonsense 46 370 2 11
ENSDART00000103234 Nonsense 46 377 2 12
ENSDART00000143267 Nonsense 46 91 2 3
ENSDART00000146326 Nonsense 46 257 2 8
Genomic Location (Zv9):
Chromosome 20 (position 26839203)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26910506
GRCz11 20 26809596
KASP Assay ID:
554-4864.1 (used for ordering genotyping assays)
KASP Sequence:
TGGTTTCAGGATGGGTCCTACCTGGCAGAGTTGCTCTTGGCTAAAGGTTA[T/A]GAGGTGGGTAAATCAACACAACCCTGAAAGACTTCCTACAAACAAGTCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43452
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046764 Nonsense 195 370 6 11
ENSDART00000103234 Nonsense 202 377 7 12
ENSDART00000143267 None None 91 None 3
ENSDART00000146326 Nonsense 202 257 7 8
Genomic Location (Zv9):
Chromosome 20 (position 26813187)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26884490
GRCz11 20 26783580
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGCTAAGCTCTATGCATACTGGATCGTTATAAACTTCAGGGAAGCCTA[T/A]AACCTCTTTGCTGTGAATGGGATCTTGTTCAATCATGAGAGTCCTAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37043
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046764 Nonsense 307 370 9 11
ENSDART00000103234 Nonsense 314 377 10 12
ENSDART00000143267 None None 91 None 3
ENSDART00000146326 None None 257 None 8
Genomic Location (Zv9):
Chromosome 20 (position 26758037)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26829340
GRCz11 20 26728430
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCTTGTTTTCAGCTGGGAGGGGAAGGATGAGAAGGAGGTGGGCCGCTG[T/A]CAGGAGACAGGAGTCATTCATGTGAGGGTTGATCCGAAATACTACCGGCC
Associated Phenotype:
Not determined