Busch Lab

ZMP

cdk2

Ensembl ID:
ENSDARG00000026577
ZFIN ID:
ZDB-GENE-040426-2741
Description:
cell division protein kinase 2 [Source:RefSeq peptide;Acc:NP_998571]
Human Orthologue:
CDK2
Human Description:
cyclin-dependent kinase 2 [Source:HGNC Symbol;Acc:1771]
Mouse Orthologue:
Cdk2
Mouse Description:
cyclin-dependent kinase 2 Gene [Source:MGI Symbol;Acc:MGI:104772]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14988 Essential Splice Site Available for shipment Available now
sa41762 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14988
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036581 Essential Splice Site 65 298 2 7
Genomic Location (Zv9):
Chromosome 11 (position 3286149)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3237637
GRCz11 11 3305797
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCGTGAGATCTCTCTGCTAAAAGAGCTCAATCACCCTAACATAGTCAAG[T/A]ATGTGCACTGTTTATGAATTTAGTCTCAAAACCAGTGAATATTTCAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41762
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036581 Nonsense 217 298 6 7
Genomic Location (Zv9):
Chromosome 11 (position 3284159)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3235647
GRCz11 11 3303807
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGCACTGTTTCCTGGAGACTCTGAAATAGATCAGCTCTTCCGGATATTT[C/T]GAACTCTGGGCACTCCTGATGAGTCTATATGGCCTGGAGTTACATCAATG
Associated Phenotype:
Not determined