Busch Lab

ZMP

alcama

Ensembl ID:
ENSDARG00000026531
ZFIN ID:
ZDB-GENE-990415-30
Description:
CD166 antigen homolog A [Source:UniProtKB/Swiss-Prot;Acc:Q90460]
Human Orthologue:
ALCAM
Human Description:
activated leukocyte cell adhesion molecule [Source:HGNC Symbol;Acc:400]
Mouse Orthologue:
Alcam
Mouse Description:
activated leukocyte cell adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:1313266]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa12510 Nonsense Available for shipment Available now
sa34926 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12510
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030138 Nonsense 261 479 6 13
ENSDART00000100180 Nonsense 206 381 5 10
ENSDART00000100184 Nonsense 290 573 6 14
ENSDART00000129400 Nonsense 260 545 6 15
Genomic Location (Zv9):
Chromosome 10 (position 29430758)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28862352
GRCz11 10 28748977
KASP Assay ID:
2260-3358.1 (used for ordering genotyping assays)
KASP Sequence:
AATGCCAGGCGGAYGGAAACCCTCCTCCTACYAGCTTCAACTTTAACATT[A/T]AGGTGAGGGACTGCCGGCAGYGTCCACAGCAACCAGACCGCTTTTAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34926
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030138 Essential Splice Site 261 479 6 13
ENSDART00000100180 Essential Splice Site 206 381 5 10
ENSDART00000100184 Essential Splice Site 290 573 6 14
ENSDART00000129400 Essential Splice Site 260 545 6 15
Genomic Location (Zv9):
Chromosome 10 (position 29430755)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28862349
GRCz11 10 28748974
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCAGGCGGACGGAAACCCTCCTCCTACCAGCTTCAACTTTAACATTAAG[G/A]TGAGGGACTGCCGGCAGTGTCCACAGCAACCAGACCGCTTTTAAATCTTC
Associated Phenotype:
Not determined