Busch Lab

ZMP

lamb1a

Ensembl ID:
ENSDARG00000026491
ZFIN ID:
ZDB-GENE-021226-1
Description:
Lamb1 protein [Source:UniProtKB/TrEMBL;Acc:Q5BJ05]
Human Orthologue:
LAMB1
Human Description:
laminin, beta 1 [Source:HGNC Symbol;Acc:6486]
Mouse Orthologue:
Lamb1
Mouse Description:
laminin B1 Gene [Source:MGI Symbol;Acc:MGI:96743]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa38110 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38110
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035247 Essential Splice Site 266 658 3 10
Genomic Location (Zv9):
Chromosome 25 (position 32550671)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31151475
GRCz11 25 31562436
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTGGCTGGACAGCTAGAGACACTGGACCTGTCTGAGCTTAGCGAGAAG[G/A]TAAAGCAGTCAACGGATTTATGATAATGGTGTATGAAAAGAGCTTATCTA
Associated Phenotype:
Not determined