Busch Lab

ZMP

arhgap12

Ensembl ID:
ENSDARG00000026482
ZFIN ID:
ZDB-GENE-040426-1727
Description:
rho GTPase-activating protein 12 [Source:RefSeq peptide;Acc:NP_957168]
Human Orthologue:
ARHGAP12
Human Description:
Rho GTPase activating protein 12 [Source:HGNC Symbol;Acc:16348]
Mouse Orthologue:
Arhgap12
Mouse Description:
Rho GTPase activating protein 12 Gene [Source:MGI Symbol;Acc:MGI:1922665]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa38897 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4468
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046959 Essential Splice Site None 817 1 17
ENSDART00000141401 None None 272 None 8

The following transcripts of ENSDARG00000026482 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 28193276)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26530885
GRCz11 12 26622245
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTCTCCAACTAACGGGCATGGCCGCTCCCAGATCCCCCTGAACGCCAGG[T/A]CAGTATGGGCAGTTTCTGCGTTCATTCTTATGCTTCAAAGGCGCATTGTT
Long Flanking Sequence:
CAAGATAAAACTGCAAATAAAAAGATTTTGCAACAAATTGAGAGGAGCTTGCTGAAAGTTTTTAATGTACTGTTGCAATACACGTTGCTTAATGCAATAGAAAACATAAAATAAAGGTTTAGTGTATAATAAAGTCCAGTGACCCAAAGTTATGCATGCAGAACCACGCAAACGCCTCTGCCTGCTTTCCACTGAGCAGAGGGGGGATCAAGAGCCTTGCAACCCCACGAGGGGGCCTGATGCGGTAACACAGGAGCATCAGCAGTCTGACAGAGCTTCACACAGGACAGGCGGGAGCGCGCAGTGACGCGAACGCGCACTCGCTCACCCACGGAGACCGACTGCGATTGGAAGCGCGAGGCGGTCAGATCGTGTGTTTTGTGTTGCTGCCGAGCACTATCTTTTTTACACGAGTGCCGAGGACTGCAAAGGGAAAAGTTTATTTCAGAGACTCTCCAACTAACGGGCATGGCCGCTCCCAGATCCCCCTGAACGCCAGG[T/A]CAGTATGGGCAGTTTCTGCGTTCATTCTTATGCTTCAAAGGCGCATTGTTGTAAATATAAAGAGTTGCATTGTTGCGAGCACTGGGGACTGATTGTTGCACAGCGGTTTGCTACCTTGCGGCCAGCCACTAAAGCCGCTTTGGGGATTCGTGGTTTGGGGGAACCTGCTATCATGCTGCGGCAAAATACTCCCATCAGGCTTTTAAATTACAGCCATGTGTTTTAACACGCAGTTGATAGCCAGTCACACTTTCGTCTTGTTATGAGATGATTCATATTATGTACATTTGTATCTGTGTATATTATTATTTCAGCTTTTGTTTTGATTAGATTTCTGTCATCAGTCAAGGGGGTTCAAACGGTTCATCAAAGTTGTTGTTATTATGGATAACGTTGGAAAACTAGTGTTGGCTTTCCCTTTGGAATCATTTTGTTTAAATTATTGTGATGTCAAATCACTTGTAATTGATCACAGTATACATTTCTTGGGTAGAACTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38897
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046959 Essential Splice Site 480 817 8 17
ENSDART00000141401 None None 272 None 8

The following transcripts of ENSDARG00000026482 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 28277791)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26615400
GRCz11 12 26706760
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGATCCTCTTTACTGTTTGCAAAGGGTCAGGGCAGCGGCACCAGCTGG[G/A]TATGTATTCATGCCAGCTTACAGTGGGGCAAATCTGGAAATGTACCCTTT
Long Flanking Sequence:
GTTTGTTGAATTTACATTGCATCTACATGTACACAATTGTCATTAGATTATAAGTAGACTGTTAGGTTTGGGTTAGGGTTAATGCAAGTTGACATGTACTTACAGTTTCTTATAAAGTTTCTTACAAAGTTTCTCAGTTGAATGTCTGTTGAAGGAGCAGTATCAACAGATATTAAGCAGACAGTCTACTAATACTCAAATGGACCATCAAAATATAGTGTTACCATAACATTAATACAAGCTATTTTGGAAAGATCTTGTGACCTCCTACAGTATATTTGTTGATACTACAATGATCTTATGTATTTTTTCAAGCTAAAAAATGCAAAGTGGCTATTTGCATGTTGTCTTTTGCACTCCCTCTTTTGATCTTTAGTCATGTGACACAGATGCATCTGTTGTTTTTAATGTCCTGCAGGAAGAATTGGGCCTCCACCTGGACGGTCCTGCAGGGATCCTCTTTACTGTTTGCAAAGGGTCAGGGCAGCGGCACCAGCTGG[G/A]TATGTATTCATGCCAGCTTACAGTGGGGCAAATCTGGAAATGTACCCTTTAAAGATGCTTTAACCTTGTTAGCCTGAAGTAACAGTTGATAGTGTTGTTTCTGTTGACATGCTTTGAATACTGACAGGTTTCCTCATACACTCAGAAAACTTGTTTCGCTGCTTGTTCAAACTTATTTAAAATGAGCTGAAATTACACAATTCTTGAGATTTTTCTTGGGACAACTTAATTGTTTAATGTTCAATCCACTTAAATTTGTAAAAACTAACAAGATAACCTAATCCCTTCATGTTGTCCCAACACATATTAAGTTAGCTTAATTGTTTTTACAAATTTAAGTGGATTGAACACAAAAATATTAAGTTGCCCCACAAAAAAATAAGAATTGTGTCGTTTCAACTCAATTAAAAAAAGTAGTTTGAACAAGCAGCAAAAGTCATTTTTTGAGTGTAGTCTGCCTGCGGTTACATACCATGTGCATCCAAATTCAGAAAACGAGA
Associated Phenotype:
Not determined