Busch Lab

ZMP

anxa5a

Ensembl ID:
ENSDARG00000026406
ZFIN ID:
ZDB-GENE-080220-29
Description:
annexin A5a [Source:RefSeq peptide;Acc:NP_001107054]
Human Orthologue:
ANXA5
Human Description:
annexin A5 [Source:HGNC Symbol;Acc:543]
Mouse Orthologue:
Anxa5
Mouse Description:
annexin A5 Gene [Source:MGI Symbol;Acc:MGI:106008]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa951 Essential Splice Site F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7747
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032342 Essential Splice Site 99 316 5 13
Genomic Location (Zv9):
Chromosome 14 (position 49360354)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47437592
GRCz11 14 46424673
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGCTCCACCAACAATATATGATGCAAATGAACTCCATAAGGCTATCAAG[G/A]TAAYCGCAAACATACTTTCATCCATCAGCAACTGASTATAATTAAAATAC
Long Flanking Sequence:
TTTAAAGCACTGACACAAATTTAATTGGTGTGTCTGCGTCATTGCTTGCAAGGTTTCTGTATTTATAACCACCTCAGAGGATATTGGGGGTCGCGAGTCACTGGCATTGTTATTTTGGGGGTCGCGGGCTGAAAAGTTTGGGAACCCCTGGCATAGAAAATGGCACTGGCCACTACAGACTCATAGAACATACGCAACATGGTGTTGCAGACTCTAAAAGATCGGAGTTTACGTAGGAAATACAGCCTACTTTGACCCTTCTTATATGTGACCAGAGAGTTCTTGGACCAGTCCAGCTTATTGTCAATATACACACCCAAATAATTATAGTCCTGAACAATCTCCACATCCACCTTGCATGTATTTTGTCTCATCCGTATCTACAGGATTTGGTAAAAGACCTCCGATCTGAGCTTGGAGGGAAGCTGGAGGATCTGATTGTGGCCCTCATGGCTCCACCAACAATATATGATGCAAATGAACTCCATAAGGCTATCAAG[G/A]TAATCGCAAACATACTTTCATCCATCAGCAACTGAGTATAATTAAAATACACAAAGAAGTGACTGCCATCACAATGTCCATTATGATAAACCTGAGCCAATCTCATCTCAGATTGTTTATCTTTTTAATTCTGCATTTCGTCACAGGGAGTGGGTACAGAGGATCAAGTATTAATCGAGATCCTTGCGTCCAGGACATGTGAAGAGATTAAAGAGATTGTCAAAGCTTATAAGAAAGGTAATATTCATTGTGCAGCCACATAATTAGGCTAAAATTTTGTAATTATTGCATGGCAGAGTCCATTTATATTTAGGAATATGCTAATGACATAAAAGATCATGTTTGGATTTTACATAAATTGTCATTTATGCAACGTATATTTCCAAATATTGCAAAAAATGGCCATTATAAATAGATTTTCAACCATTGTAATTTAAAATATGTACACATATGTTCAAATATACGATATATGTGCATATATGAAAACAACATTACAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa951
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032342 Essential Splice Site 130 316 6 13
Genomic Location (Zv9):
Chromosome 14 (position 49360593)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47437831
GRCz11 14 46424912
KASP Assay ID:
554-0856.1 (used for ordering genotyping assays)
KASP Sequence:
TCCAGGACATGTGAAGAGATTAAAGAGATTGTCAAAGCTTATAAGAAAGG[T/A]AATATTCATTGTGCAGCCACATAATTAGGCTAAAATTTTGTAATTATTGC
Long Flanking Sequence:
ATACAGCCTACTTTGACCCTTCTTATATGTGACCAGAGAGTTCTTGGACCAGTCCAGCTTATTGTCAATATACACACCCAAATAATTATAGTCCTGAACAATCTCCACATCCACCTTGCATGTATTTTGTCTCATCCGTATCTACAGGATTTGGTAAAAGACCTCCGATCTGAGCTTGGAGGGAAGCTGGAGGATCTGATTGTGGCCCTCATGGCTCCACCAACAATATATGATGCAAATGAACTCCATAAGGCTATCAAGGTAATCGCAAACATACTTTCATCCATCAGCAACTGAGTATAATTAAAATACACAAAGAAGTGACTGCCATCACAATGTCCATTATGATAAACCTGAGCCAATCTCATCTCAGATTGTTTATCTTTTTAATTCTGCATTTCGTCACAGGGAGTGGGTACAGAGGATCAAGTATTAATCGAGATCCTTGCGTCCAGGACATGTGAAGAGATTAAAGAGATTGTCAAAGCTTATAAGAAAGG[T/A]AATATTCATTGTGCAGCCACATAATTAGGCTAAAATTTTGTAATTATTGCATGGCAGAGTCCATTTATATTTAGGAATATGCTAATGACATAAAAGATCATGTTTGGATTTTACATAAATTGTCATTTATGCAACGTATATTTCCAAATATTGCAAAAAATGGCCATTATAAATAGATTTTCAACCATTGTAATTTAAAATATGTACACATATGTTCAAATATACGATATATGTGCATATATGAAAACAACATTACAGCTAATATATTGAACATATACTCACCGGCCACTTTATTAGGTACACCTTACTTGTACCGGGTTGGACTTCCTTTTTCCTTTAGAGCTGCCTTAATCCTTCATATCATAGATTCAACAAGGTACTGGAAAATTCCTTATTGACATGATAGCATTACGTAGTTGCTGCAGATTTGTTGGCTTCTCTATTGGATTGAGGTCTGGTGACTGTGGAGGCCATTTGAGTACAGTGAACTCATTGTCATG
Associated Phenotype:
Not determined