Busch Lab

ZMP

si:ch73-60g14.3

Ensembl ID:
ENSDARG00000026403
ZFIN ID:
ZDB-GENE-091204-388
Human Orthologue:
HEPHL1
Human Description:
hephaestin-like 1 [Source:HGNC Symbol;Acc:30477]
Mouse Orthologue:
Hephl1
Mouse Description:
hephaestin-like 1 Gene [Source:MGI Symbol;Acc:MGI:2685355]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa7219 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41658 Nonsense Mutation detected in F1 DNA Not yet available
sa34902 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34901 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7219
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064733 Essential Splice Site 9 1091 2 20
ENSDART00000135985 None None 197 None 4
Genomic Location (Zv9):
Chromosome 10 (position 24847497)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24446849
GRCz11 10 24416301
KASP Assay ID:
554-4523.1 (used for ordering genotyping assays)
KASP Sequence:
TCTCTGCTGCAGAATWATTTGAGAACCCTAGCTGGGCAGTTGTGTTCTTT[C/T]GGAAACTATGCTTTCTTTCCTGGAGTTTTTGGGAAGCTTGAGCATCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41658
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064733 Nonsense 63 1091 2 20
ENSDART00000135985 None None 197 None 4
Genomic Location (Zv9):
Chromosome 10 (position 24847333)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24446685
GRCz11 10 24416137
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGGGATTATGCACCAAGTGGACAGAATCTGATCAATGGGAAGCGTATT[G/T]AAGAGGATGAGTAAGAGATTTATTTATTTATACAAATAAATACATTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34902
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064733 Essential Splice Site 66 1091 None 20
ENSDART00000135985 None None 197 None 4
Genomic Location (Zv9):
Chromosome 10 (position 24842343)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24441695
GRCz11 10 24411147
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTTTAAGCTAATAATTCTTCAGAAAACTCTACTTACTTTCTTTTTCCTC[A/C]GGCAGGCATCAGTATTTCTGCAACGTGGGGCTCGGCGGATTGGCAGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34901
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064733 Nonsense 483 1091 9 20
ENSDART00000135985 None None 197 None 4
Genomic Location (Zv9):
Chromosome 10 (position 24837362)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24436714
GRCz11 10 24406166
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTACTGAGGGCAGAGGTTGGAGATACACTTCAGGTGATGTTCATGAAT[A/T]AAGCTGACAGAAACTACAGTATCCAGCCTCATGGACTCCAGTACGACAAA
Associated Phenotype:
Not determined