Busch Lab

ZMP

rfx4

Ensembl ID:
ENSDARG00000026395
ZFIN ID:
ZDB-GENE-040909-2
Description:
Transcription factor RFX4 [Source:UniProtKB/Swiss-Prot;Acc:A2BGA0]
Human Orthologue:
RFX4
Human Description:
regulatory factor X, 4 (influences HLA class II expression) [Source:HGNC Symbol;Acc:9985]
Mouse Orthologue:
Rfx4
Mouse Description:
regulatory factor X, 4 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:1918387]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa36604 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36604
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031752 Nonsense 675 735 18 18
Genomic Location (Zv9):
Chromosome 18 (position 14921075)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15366493
GRCz11 18 15335005
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTGTCTAATGAGCGGCTCTCCTCTCCTACACTCCAGTCCAGTGACCCCT[C/T]GATGGCCCGATGTGCCCTCTGCCAACAGCTGTTACTCCAGTCCCACCGTC
Associated Phenotype:
Not determined