Busch Lab

ZMP

A4IGH1_DANRE

Ensembl ID:
ENSDARG00000026383
Description:
LOC100006464 protein [Source:UniProtKB/TrEMBL;Acc:A4IGH1]
Human Orthologues:
RASD1, RASD2
Human Descriptions:
RAS, dexamethasone-induced 1 [Source:HGNC Symbol;Acc:15828]
RASD family, member 2 [Source:HGNC Symbol;Acc:18229]
Mouse Orthologues:
Rasd1, Rasd2
Mouse Descriptions:
RAS, dexamethasone-induced 1 Gene [Source:MGI Symbol;Acc:MGI:1270848]
RASD family, member 2 Gene [Source:MGI Symbol;Acc:MGI:1922391]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25705
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034898 Essential Splice Site 211 387 1 2
Genomic Location (Zv9):
Chromosome 1 (position 57738416)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 56564867
GRCz11 1 57279954
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCCGGGGAGAGGAGCTTCCCCGCCAAGAGGAGACTCTCCATTCTCACTG[G/A]TGCGTAAAAGTTTAATAACGCAACATTGCGGTTGTTTTGGAGTCCTTGGT
Long Flanking Sequence:
TAGCGTCCTGCTCGCGTACAAAAACGCGACGCAAAGACTCGGCGCGAGCGGGTTCAAAGTCAGCGCGCTCTCCAAAGCAGGAATGGGCATCCTGAAGCTGGCCACGACGCAGCTAAAACAGCAGGAGAAGAAGGCGAGGGTGGTGCGCGCGTCCAGTCAGGGAAAAGCGCATCCACCTATTGACAAAAAGTCTCCTTTGGATCAACTGGCTGCACTGGTTTTGCACGGCCACGCGCGTCTACAGCCCATCGCGCACGAGTCGCACGCCACCAAACCGCAGAACTGCAGGCGCATAGTGGTGCTCGGCGCGCCGCGCGTTGGGAAGACCTCCATCCTGCGCCGGTTCCTGCGAGATGGCTTTGAGGAGCAATACGAGCCCACATGCGAAGATTTCCACAGAAAACTCTACCAAATACGAGGAGAAACATACCAGATAGACATACTGGACGCGTCCGGGGAGAGGAGCTTCCCCGCCAAGAGGAGACTCTCCATTCTCACTG[G/A]TGCGTAAAAGTTTAATAACGCAACATTGCGGTTGTTTTGGAGTCCTTGGTGGCACCTTGGCTTTTTGTATGACTGTATTGGGTTCAATCATACTGATAAAGTGCCTATGAAATTATTTTGGTTTTTAAAACACTTTATAAATGCTGCGTTGTTTAAATAATGTTGGGTCAAAATATTGACAACCCCAATGTTGAGGGTATTTGTCATTTACATTTAAATTACACTTTTGAGTTCGTATTTTAGAGCATAATTTACCCAATGTTGGGTTAAAATTACCCAGCATTTTGGTGATTGGACGCACTTGCGTAAAATGAAACATCATTAAAACCGCAGGCAATAATCATATGATCAATCAACAAATGTTGGGTTGTTTTAACTCAATGTTGGATCAAAAATACGAACTAAAAGTGTTATTTAAATGTAAATAAAAAATACCCTCAATTGGAAAAACCCACAAGAAAAAACGTTGGGCTTGTCCATATTTGACCCATATGGGTTAA
Associated Phenotype:
Not determined