Busch Lab

ZMP

aco1

Ensembl ID:
ENSDARG00000026376
ZFIN ID:
ZDB-GENE-031118-76
Description:
cytoplasmic aconitate hydratase [Source:RefSeq peptide;Acc:NP_001030155]
Human Orthologue:
ACO1
Human Description:
aconitase 1, soluble [Source:HGNC Symbol;Acc:117]
Mouse Orthologue:
Aco1
Mouse Description:
aconitase 1 Gene [Source:MGI Symbol;Acc:MGI:87879]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa17511 Essential Splice Site Available for shipment Available now
sa27109 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa27108 Nonsense Mutation detected in F1 DNA Not yet available
sa21154 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17511
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045253 Essential Splice Site 39 896 1 20
Genomic Location (Zv9):
Chromosome 7 (position 75172360)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71243237
GRCz11 7 71484378
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCGGACCACAAGTTCTWCAACCTCAGAAARCTTAAAGACCCCAGATATGG[T/A]AAGATCATTTTTGATGCGTGTTTYATTGSATTATTTAACCCTTTAAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27109
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045253 Essential Splice Site 164 896 4 20
Genomic Location (Zv9):
Chromosome 7 (position 75170304)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71241181
GRCz11 7 71482322
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAGATCTTGAATTTGAAAGGAACAGGGAACGCTTTGAGTTCTTAAAGG[T/A]GATTTTGGTTCTTTCTTCACGTCGCATTTAGTAATAATGTTTGCATCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27108
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045253 Nonsense 756 896 18 20
Genomic Location (Zv9):
Chromosome 7 (position 75153474)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71224351
GRCz11 7 71465492
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTGTTACCTGTTATTTATCTGTGTTTCGTTTGTTGGTGTGTTTTCAGT[T/A]GGATGTGTTTGATGCTGCAGAAAAGTATCAACAGGCTGGTCATCCTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21154
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045253 Nonsense 824 896 19 20
Genomic Location (Zv9):
Chromosome 7 (position 75151910)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71222787
GRCz11 7 71463928
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGATTCACCGCAGTAATCTAGTGGGCATGGGTGTAATTCCTCTGGAGTA[T/A]CTGCCGGGAGACTCAGCGGAGAGTTTGGGTCTCAGCGGACGCGAGCGCTA
Associated Phenotype:
Not determined