Busch Lab

ZMP

wasb

Ensembl ID:
ENSDARG00000026350
ZFIN ID:
ZDB-GENE-030131-7098
Description:
Wiskott-Aldrich syndrome (eczema-thrombocytopenia) b [Source:RefSeq peptide;Acc:NP_956232]
Human Orthologue:
WAS
Human Description:
Wiskott-Aldrich syndrome (eczema-thrombocytopenia) [Source:HGNC Symbol;Acc:12731]
Mouse Orthologue:
Was
Mouse Description:
Wiskott-Aldrich syndrome homolog (human) Gene [Source:MGI Symbol;Acc:MGI:105059]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa1001 Essential Splice Site Available for shipment Available now
hu3279 Nonsense Available for shipment Available now
sa16049 Essential Splice Site Available for shipment Available now
sa34392 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa1001
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039080 Essential Splice Site 152 479 5 12
ENSDART00000139084 Essential Splice Site 23 271 2 7
Genomic Location (Zv9):
Chromosome 8 (position 24425851)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23551669
GRCz11 8 23572908
KASP Assay ID:
554-0905.1 (used for ordering genotyping assays)
KASP Sequence:
GTTTTTACATTTAAATATTTAGAAAAAAGACAGCATGCTCCATCTGAAGG[T/A]ATGCRTCTAGAGTTTAAACATACACTTGGTCTGAATTGTAAKATTAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3279
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039080 Nonsense 320 479 10 12
ENSDART00000139084 Nonsense 182 271 7 7
Genomic Location (Zv9):
Chromosome 8 (position 24420683)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23546501
GRCz11 8 23567740
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCTCCTCCACCTCGTGGTGGGCTTTCCTCAGTCCCTGGACCAACCGGA[C/T]GACCTCCACCACCATCACGCAGTCCGGGACCCCCACATCGTGGTCCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16049
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039080 Essential Splice Site 424 479 10 12
ENSDART00000139084 None None 271 None 7
Genomic Location (Zv9):
Chromosome 8 (position 24420367)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23546185
GRCz11 8 23567424
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GMGAGGAACTTTACTGGAGGAAATTCGGCGTGGACGTGTRCTAAAAAATG[T/C]ATGTGAGACATTATCATGTAAAAAAAAYGCAATGCACTTTGTTWAATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34392
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039080 Essential Splice Site 462 479 11 12
ENSDART00000139084 None None 271 None 7
Genomic Location (Zv9):
Chromosome 8 (position 24420054)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23545872
GRCz11 8 23567111
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTTGATGATGGTGATGCAGAAAAGGAGTAAAGTTATCCATTCATCAGG[T/G]AACTCATTTAATAAACCTCACAGTCAGCATGAAATGGAAGCTAAGATTGT
Associated Phenotype:
Not determined