Busch Lab

ZMP

ARHGAP29 (1 of 2)

Ensembl ID:
ENSDARG00000026329
Description:
Rho GTPase activating protein 29 [Source:HGNC Symbol;Acc:30207]
Human Orthologue:
ARHGAP29
Human Description:
Rho GTPase activating protein 29 [Source:HGNC Symbol;Acc:30207]
Mouse Orthologue:
Arhgap29
Mouse Description:
Rho GTPase activating protein 29 Gene [Source:MGI Symbol;Acc:MGI:2443818]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa14982 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14982
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018037 Nonsense 1318 1344 22 22
Genomic Location (Zv9):
Chromosome 24 (position 29479075)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 28477391
GRCz11 24 28556550
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATACAAGNNNNNNTCCACTTCCTGAATCGCCAAGCTCCAGCCCCGAGGAACTCGGA[C/T]AAAATGAGACCAAACCTGTGTACCAGAGACTCCGATCACGGCGCATGCAG
Associated Phenotype:
Not determined