Busch Lab

ZMP

erbb2

Ensembl ID:
ENSDARG00000026294
ZFIN ID:
ZDB-GENE-031118-121
Description:
receptor tyrosine-protein kinase erbB-2 [Source:RefSeq peptide;Acc:NP_956413]
Human Orthologue:
ERBB2
Human Description:
v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homol
Mouse Orthologue:
Erbb2
Mouse Description:
v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homol

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa18607 Nonsense Available for shipment Available now
sa35218 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa27894 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27896
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003932 Nonsense 114 1275 3 27
ENSDART00000114258 Nonsense 114 1275 3 28

The following transcripts of ENSDARG00000026294 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 10165111)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9373066
GRCz11 12 9410909
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGACAATCTGCGGATTATACGAGGCAGTCAGCTTTATAAATCCAACTA[T/A]GCTCTCGCTGTACACAACAACAGCAACAGCAGTCAGGCTGGACTCGGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18607
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003932 Nonsense 197 1275 5 27
ENSDART00000114258 Nonsense 197 1275 5 28

The following transcripts of ENSDARG00000026294 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 10160581)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9368536
GRCz11 12 9406379
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTTTTTTCAGGTCCTCGYTGCTCTTCAGCTTGYAAATCYGGTGGATGTT[G/A]GGGAGAAAAAGATCAGGACTGCCAAACAWGTGAGTGTGATTGATACAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35218
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003932 Essential Splice Site 545 1275 13 27
ENSDART00000114258 Essential Splice Site 545 1275 13 28

The following transcripts of ENSDARG00000026294 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 10144782)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9352737
GRCz11 12 9390580
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTACAAACGAGGAACTGAGTGTGTGGAGCTGTGTAATGTCCTACACGGG[T/A]GAGTAAAACACATATTTTTTTTGCCTTTTGTGCTTTGTTGTTTATACTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27895
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003932 Nonsense 562 1275 14 27
ENSDART00000114258 Nonsense 562 1275 14 28

The following transcripts of ENSDARG00000026294 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 10143722)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9351677
GRCz11 12 9389520
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTCAGTGCGGGAGTTTGAGGATGGATTTAACTGTGTTCCTTGTCATCCC[G/T]AGTGTCGACCAATCAATGGCACTGCCTCCTGTACAGGCCCAGTAAGAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27894
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003932 Nonsense 774 1275 20 27
ENSDART00000114258 Nonsense 774 1275 20 28

The following transcripts of ENSDARG00000026294 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 10132868)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9340823
GRCz11 12 9378666
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCTTTCTCCACAGGAGGCTTATGTGATGGCGGGTGTAGCGAGCCCATA[T/G]GTGTGCCGTTTGCTGGGAATCTGTCTGACATCAACGGTTCAGCTGGTTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4453
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003932 Nonsense 991 1275 25 27
ENSDART00000114258 Nonsense 991 1275 25 28

The following transcripts of ENSDARG00000026294 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 10122295)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9330250
GRCz11 12 9368093
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATGATAGCATTTCTCTCCTTTCCACAGAACGAAGATCAGATGAGTCTKT[C/A]GAGTCCTGTTGATAGCGAGTTCTTCCGCATCYTGATGGCAGAGGAGGGCG
Associated Phenotype:
Not determined