Busch Lab

ZMP

LOC565564

Ensembl ID:
ENSDARG00000026246
Human Orthologue:
ADORA3
Human Description:
adenosine A3 receptor [Source:HGNC Symbol;Acc:268]
Mouse Orthologues:
Adora3, Adora3
Mouse Descriptions:
adenosine A3 receptor Gene [Source:MGI Symbol;Acc:MGI:104847]
adenosine A3 receptor Gene [Source:MGI Symbol;Acc:MGI:104847]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa20824 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20824
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064679 Nonsense 130 299 2 2
Genomic Location (Zv9):
Chromosome 6 (position 54437751)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54474485
GRCz11 6 54482593
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAATCTCTTTCTATAGGTACAGGGGAGCAGTCAAAAAGCAGCACTTGT[G/A]GATTGCGGTCACTGTTTGTTGGCTCTCGGCTGCTATACTGGGTCTAATCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1589
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064679 Nonsense 137 299 2 2
Genomic Location (Zv9):
Chromosome 6 (position 54437730)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54474464
GRCz11 6 54482572
KASP Assay ID:
554-1531.1 (used for ordering genotyping assays)
KASP Sequence:
CAGGGGAGCAGTCAAAAAGCAGCACTTGTGGATTGCGGTCACTGTTTGTT[G/A]GCTCTCGGCTGCTATACTGGGTCTAATCCCGATGTTCGGATGGCACAAAG
Associated Phenotype:
Not determined