Busch Lab

ZMP

zgc:56585

Ensembl ID:
ENSDARG00000026236
ZFIN ID:
ZDB-GENE-040426-1084
Description:
hypothetical protein LOC393297 [Source:RefSeq peptide;Acc:NP_956621]
Human Orthologue:
HPGD
Human Description:
hydroxyprostaglandin dehydrogenase 15-(NAD) [Source:HGNC Symbol;Acc:5154]
Mouse Orthologue:
Hpgd
Mouse Description:
hydroxyprostaglandin dehydrogenase 15 (NAD) Gene [Source:MGI Symbol;Acc:MGI:108085]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa16801 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16801
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029708 Nonsense 23 270 2 9
ENSDART00000136402 Nonsense 23 270 2 8
Genomic Location (Zv9):
Chromosome 21 (position 33809382)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34809075
GRCz11 21 34843565
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGTTGCTGTTGYGACCGGAGCAGCTCAGGGTTTGGGCAGAAGTTTTGTC[G/T]AAATACTCATGAAAAATGGGTCAAAGGTAAACTAAATAATACAAATCATA
Long Flanking Sequence:
TGTTATACTTCACATTTTACTTCGGCTCACACACCCATTGAAGACCCGTTATGTTTTGTTTGGCGTGTTTGATGTTAAACTCCTCCCCCTCACTTGGCTTATGTTCATCGGTCACTCTTTCACTATTTCAGTAGTTGCTACTCCAAACGCTGTTCGGACGCACAGGTAGGATTAACAATGTTTTGTTTTGTTTTGTTTTGTTTTATGATTTTTATAGGCTAGAGGTGAAAAAGATCGTTATTTACTAAAGTTTTGGACAAGCAGAAAGAATAGCATTACTGTCTGCTTTAATAACAGGCTTTTTTCTACTTCATTTTTTTTTCTTACATTAGATACAGGTTTTAAAAAGTTTTAATGGAAGCCTGTTGCTTCAAATGAATCTTTACGAGAGATAAAATAGACAATATGTTATTTCCACAGGTGTGTAGCTGACGATGGATTTAAAGGATAAAGTTGCTGTTGTGACCGGAGCAGCTCAGGGTTTGGGCAGAAGTTTTGTC[G/T]AAATACTCATGAAAAATGGGTCAAAGGTAAACTAAATAATACAAATCATATTAAAAAAAAATTGTTCGCGTTAATACAAACTCCAAGGACACTAAATCAACTATGTAATTGAACATAAAGTGTTACGTAATTAAGTTTTATTTACGTTACCATGTCATTGAGGGTAAAACGCCTGCTTCAGGTTCCGATTAAAAGCGTCGCAGCTGTGTCGACTCGGCTATGCATTGATAAGTACAGTTTCGGTTTTATAAAGCTGAAAATAGGGAAAAGAGCTATTCGTACATAACATTTGGCCGTTGATATTGAGTCATGAGGAAAAAATTAATTGATGTTCATCAAAGGTTAGCCTAGATCTGACATACAGACTATGCAAAAGTGTGGTAATAACTGACAGCAATAAGACATCTTGATTTGTCGAAAGTTAATCTCTGGTGGTTATTGTATTTTTTATGTATTTAAAGTACATTAGTAGCCTACTACATGTTGTTTATTGCATTAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29637
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029708 Essential Splice Site 141 270 5 9
ENSDART00000136402 Essential Splice Site 141 270 5 8
Genomic Location (Zv9):
Chromosome 21 (position 33805929)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34805622
GRCz11 21 34840112
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAATGGTGGCAGTGGTGGAGTCATTGTCAACGTTGCATCCATGGCAGG[T/G]TTGGGACCGTCTGTACATAAAATGAACAAAAACACAGCTTGAAAACGTGG
Long Flanking Sequence:
GTCTGTCTGAAAGAAGAAAGTCATACACATCAGATGGCTTAAGGTTAAGTAAATTATGCGGCCATTTTTATTTTTGGGTGGACTTTCTTTTAAGCAATTTATGTAGAAATAATTAGATGACACTATAATTTAATTTATATCAAACAAGTTTACAACTGATTGCATTGAAAGAAACTGTCTTTGTCTTCTGAAAGCTTTACATTTTCCTTTACAGGAGTTTTGAAAAAAATTGTAGAGCAATTTGGCCAAATAGACATCATGTGCAACAACGCTGGCATCATCAATGAAAAGCACTGGGAAAAGACTATTGCAATAAACCTGGTATGAACCTTTCCGTCTGTCTTTACCTACATAACTGCATCTGGTTTTGCTTTAGCTGAACATTCTTTGTGGTCATTTCAGGGTGGTGTGGTCAGGGGCACGTATCTCGCTCTGGAATATATGAAGAAAGAAAATGGTGGCAGTGGTGGAGTCATTGTCAACGTTGCATCCATGGCAGG[T/G]TTGGGACCGTCTGTACATAAAATGAACAAAAACACAGCTTGAAAACGTGGTAAATGACTTAGAAAAAACAATATTTGTGGATTTAAACAGATATTTCTTCTAAAATTGAAAACTTTAAGCAAGCATTTTTTGCTTTTAAAAGATGTCTAGTAGCTGTCTAAACATAGTCGTCTTAGCTAAAACAAGGCTAAATTTGGGCTGTTAATGAAAATCTAATAGTTGTCTAAGAATAAGTCAAAACTAGACAAGTCATCAAATAAACAAATGAATGACTACACATATAAAGTCTGTCTAATCGGTCTATTTGACGACTAGTCTAGTTTTAAGCTGTTCTTAAATGTCTATTAGACTTGTCTATTAGACAAGTTTAGCCTTGTTTTAGCCAAGTTGTCTACATTTAGATGTCTACTAGACAAGCACAAAATTGTTTGATGGACTGTGTTAGATGTGTAACCATTCTTTGGTGGTTTGCCAATGTATATAATTGCTCTAATACATAA
Associated Phenotype:
Not determined