Busch Lab

ZMP

prpf8

Ensembl ID:
ENSDARG00000026180
ZFIN ID:
ZDB-GENE-030131-577
Description:
pre-mRNA processing factor 8 [Source:RefSeq peptide;Acc:NP_957270]
Human Orthologue:
PRPF8
Human Description:
PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17340]
Mouse Orthologue:
Prpf8
Mouse Description:
pre-mRNA processing factor 8 Gene [Source:MGI Symbol;Acc:MGI:2179381]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa2823 Nonsense F2 line generated Not yet available
sa1289 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa2823
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026434 Nonsense 1400 2342 24 41
ENSDART00000134601 Nonsense 1400 2342 25 42
Genomic Location (Zv9):
Chromosome 15 (position 27603302)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28321542
GRCz11 15 28254418
KASP Assay ID:
554-3379.1 (used for ordering genotyping assays)
KASP Sequence:
AGAGTGAGTTCATTGATTCTCAGAGAGTTTGGGCTGAATATGCCCTCAAG[C/T]GACAGGAGGCCATTGCTCAGAACAGGTACTGTCCTCTAAACCAAACCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1289
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026434 Nonsense 2042 2342 36 41
ENSDART00000134601 Nonsense 2042 2342 37 42
Genomic Location (Zv9):
Chromosome 15 (position 27600100)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28318340
GRCz11 15 28251216
KASP Assay ID:
554-1204.1 (used for ordering genotyping assays)
KASP Sequence:
CTCCATCCCAGCAGAGACAGCAGATCGCTGAGATTGAGAAGCAGACCAAA[G/T]AGCAGTCTCAGCTTACGGCCACTCAGACTCGCACAGTCAACAAACACGGA
Associated Phenotype:
Not determined