Busch Lab

ZMP

ube2cbp

Ensembl ID:
ENSDARG00000026178
ZFIN ID:
ZDB-GENE-091218-3
Description:
LOC553294 protein [Source:UniProtKB/TrEMBL;Acc:Q5EAZ8]
Human Orthologue:
UBE2CBP
Human Description:
ubiquitin-conjugating enzyme E2C binding protein [Source:HGNC Symbol;Acc:21381]
Mouse Orthologue:
Ube2cbp
Mouse Description:
ubiquitin-conjugating enzyme E2C binding protein Gene [Source:MGI Symbol;Acc:MGI:1917598]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa2843 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7776
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038036 Nonsense 2 394 1 10
Genomic Location (Zv9):
Chromosome 16 (position 5715136)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4941119
GRCz11 16 4770408
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGTGTCGCRTGGGATTTAWGAGTAGAATCGATGAATCCATAGCTTCTG[T/A]AAAGAAATACCAATGGAAGAGACTRCGAACACAGAWGTCCTCTTTMTTGA
Long Flanking Sequence:
TAGCGCACAGTTTGACGTCACGTCTCGAAGTCCGCGCGCTCACAGTACGCGTGCGCGTGTGTCATCTGCCGCGAGTCCCACACGTATACTGTAAAAGTCCACAGAAGCTTGTATGTTGTTAAAATAGTTTTTAAATAAAAATAAAGCATAAAAATAAATAAAAACAACAAACATTCTGTAATCTTTCTTCACTGAAATTTACATTAAAACGTTTACGCTCGTTCTCATAGGTTTTGGAATAGTTAAAGCATGTAAGCGGGCTAAGCCCAGTCATATATTGTTTATATATTAAAATAAAATAATTATAATAACTGTCCTAATATGTTTAAAAACAGCGTTTTTAAAAAATGTTTTTAAAAGTAACGTTAACACTGAACAGATGCAAACTGAATTCTGAAGACTCTTAATATGAAATGACGGTGTCGCAGACATTTTGTCGTCACGTTGTTTTGTGTGTCGCGTGGGATTTAAGAGTAGAATCGATGAATCCATAGCTTCTG[T/A]AAAGAAATACCAATGGAAGAGACTGCGAACACAGATGTCCTCTTTATTGAGCTCAGACAGAAGCTGCAAAGCGGCCTTTTGTTCATTCGGTAAAGTTTTTCTCTTCTACTTTGGCTCTCTCATGGTCACTGACTGTCAATGCAGTGTTTCATCAGTGTATGTGAGTGAATTATGTCATGTACAGATACACTTAGCACCCAGGGTTTTAACGGGATTTCTTTTAACGTACTAGGGTAACGTTACAGCTCATTTTGAGTTTATTTACTGGAATAATAGGTTATACAATTTCAGGAGGCAGACTTTGGGAACACTAAGTTAGAGAGTACTAAAATATAGTCGTTTAAATGTTTATAGCTAGGTTTTAAAAATATTTATATAGTATACTGAATTATATATATTATACTATTGCATACTGTTTTATTTTTTACACTAGCTCTATAAGATAAAAACGGTTAGAAATGCCACAATGAAACACTAGATGGCAGTATTGGCCAGATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2843
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038036 Nonsense 134 394 4 10
Genomic Location (Zv9):
Chromosome 16 (position 5721504)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4947487
GRCz11 16 4776776
KASP Assay ID:
554-2601.1 (used for ordering genotyping assays)
KASP Sequence:
TGAGTAAATGTTCATTTTTGGGTGAACTGTCTCTTTAAAGGTCTTTTGGA[C/T]GAGTTCTTCCTTTGCCCAATGGAAACTGGAATGCATTAGTGGACGACTGG
Long Flanking Sequence:
AGGGCTATATCAGCCATTTGGGAAGGGGCTATCGATCCTATAGGGAGGGGCTATCAATCCTTTAGGGAGGGGCTATTAGTCCTTTAGGGATTGGCTATTAGTCCTTTAGGGAGGGGCTATTAGTTTTTTAGGGCCTGTCTATCAGAATTTGTTCATTCGTCAATCTTCCTTCATTTTGTTAGCAGCCCTTTGTCTTTCCAATCGGGTCCCAAAGGACGAAATCATGCCCCGTCCTACATTTGTTTCTCATTTCAGGACATTTCAAGTGGATGTACGTCACGATAGCAGAAAAAAGGACAATCTTAACTACTGTTTATTGGCGACTTGGAGACTCTGAATCCAACACATACGGCCTATAACTCTGGAGTATGATCACATAGTGACTCTAAAGTGGAAAACATATTAGAGAGCTTTAATTAAGATCAGAGAAGTCAATGTAGGATCTTAAATTGAGTAAATGTTCATTTTTGGGTGAACTGTCTCTTTAAAGGTCTTTTGGA[C/T]GAGTTCTTCCTTTGCCCAATGGAAACTGGAATGCATTAGTGGACGACTGGTGCTGCCATCCAGATCCCTTCGCCAACAGAAAACTGCTGCCGCGAGCTGGAGACTGCCTGCTGGGGGACACCTTCATTCTGCTGCTGCGGGACGACGGCTGCGATGAGAGTCTGACACGGGCCGCTGCAGAGGTAACAGTGTGAAGCGCACCTAATTGTGCATTTTCAGATGTCACTTTTTACATCGTGTGAGATGTAGCTGTGTGTGAATTAGTGCTGCACAATATCCGCAATGTGTGAATCTGCAATAGTCGCATCACTGAATCTGCAATGTGGAGTTGTGGTTATAATGAACCAGAAAACACAGTTCAGAAAGACGCAAAAGCAAAACAATTATGAGAGAAAAAACTAAGCTGAAAACTAGCAGGCCCAGATTTGTCTTCCTGCTGATGTTTCTATTGCGGTCGTGATATTTTGGCGGTTCTCTTTCTAACACAGCCTCAGGCCTGA
Associated Phenotype:
Not determined