Busch Lab

ZMP

hps1

Ensembl ID:
ENSDARG00000026170
ZFIN ID:
ZDB-GENE-051113-152
Description:
Hermansky-Pudlak syndrome 1 protein [Source:RefSeq peptide;Acc:NP_001032777]
Human Orthologue:
HPS1
Human Description:
Hermansky-Pudlak syndrome 1 [Source:HGNC Symbol;Acc:5163]
Mouse Orthologue:
Hps1
Mouse Description:
Hermansky-Pudlak syndrome 1 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:2177763]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa17216 Essential Splice Site Available for shipment Available now
sa42277 Nonsense Mutation detected in F1 DNA Not yet available
sa1853 Essential Splice Site F2 line generated Not yet available
sa35570 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17216
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057047 Essential Splice Site 39 668 None 19
ENSDART00000109822 Essential Splice Site 39 668 None 17
ENSDART00000146112 Essential Splice Site 39 56 None 4

The following transcripts of ENSDARG00000026170 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 41306604)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 40568656
GRCz11 13 40694546
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAGCGGCTTCAGGAGCAGTATGGARTCTCCCAGGAGGAAGGAGAAGGAG[T/A]ATGNNTTTTTTTTTGCTCTAGATTATCAAATAGTGCTGTTTGRCTTTCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42277
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057047 Nonsense 109 668 5 19
ENSDART00000109822 Nonsense 109 668 3 17
ENSDART00000146112 None None 56 None 4

The following transcripts of ENSDARG00000026170 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 41312262)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 40574314
GRCz11 13 40700204
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGAACGGAGACGGAGAGGAGACCGAAGAGGATTTGAAGAGAAAGATCTA[C/A]GTGATGAAGAAACTCACAGAAATCCTGTTTGGGATGGTGACGCTCAGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1853
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057047 Essential Splice Site 222 668 8 19
ENSDART00000109822 Essential Splice Site 222 668 6 17
ENSDART00000146112 None None 56 None 4

The following transcripts of ENSDARG00000026170 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 41314833)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 40576885
GRCz11 13 40702775
KASP Assay ID:
554-1844.1 (used for ordering genotyping assays)
KASP Sequence:
TAATGTAATTAATTGTAATCCAAATGTAATTCTTTTTTTTTCTGTGTGCA[G/A]TCGTAATGCCAGCAATCTGAACCCTTCTGATCTCCTGGCTCTGATCATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35570
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057047 Essential Splice Site 615 668 18 19
ENSDART00000109822 Essential Splice Site 615 668 16 17
ENSDART00000146112 None None 56 None 4

The following transcripts of ENSDARG00000026170 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 41324325)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 40586377
GRCz11 13 40712267
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCCAGATGACACCGCTCCAATAGGAATGCTCACATTTGATTATTATAGG[T/G]ATGAGAATTCACATGCAAGCTGATGCATCTTTAACATTTCTTGGTAAAGC
Associated Phenotype:
Not determined