Busch Lab

ZMP

col11a1a

Ensembl ID:
ENSDARG00000026165
ZFIN IDs:
ZDB-GENE-070209-167, ZDB-GENE-070209-167
Description:
collagen, type XI, alpha 1 [Source:RefSeq peptide;Acc:NP_001077313]
Human Orthologue:
COL11A1
Human Description:
collagen, type XI, alpha 1 [Source:HGNC Symbol;Acc:2186]
Mouse Orthologue:
Col11a1
Mouse Description:
collagen, type XI, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88446]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa13850 Nonsense Available for shipment Available now
sa8893 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32491 Essential Splice Site Available for shipment Available now
sa44162 Nonsense Mutation detected in F1 DNA Not yet available
sa24520 Essential Splice Site Available for shipment Available now
sa39459 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11965 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13850
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503 None None 231 2 67
ENSDART00000042065 Nonsense 78 1736 2 66
Genomic Location (Zv9):
Chromosome 24 (position 29808990)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 28807306
GRCz11 24 28886465
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CKTCAGGATTCTGCACAAACCGAAGAGCATCACAGCCAGACGCGGCCTAC[A/T]AAATCAGCAAGAATGCCCAGCTCAGTGCCCCGACCAAGCAGCTTTTCCCA
Long Flanking Sequence:
AGGGAAGGCTAAACTGTCCGTGGTGTATGTGTGTGAATGAGTGTTTCCCAGTACTGGGTTGCAGCTGGAAGGGAATCCACTGTTTAAAACATATTTTGGAGTAGTTGGCGGTTCATTCCGCTGTGGCGACTGCTGATAAATAAAGACTAAGCTGAAGGAAAATGAATGAATGAATGAATAATATAATTCATTCCAATGTTTTTTTTTTTTTTTTTTTTTTGTTATTGTAAGTGTGGATGTTAGAATGTCATTCTGTTGAAGCTGAAGTTAACTGCAATATAATAACGTTAATCATTTGCTAAACATTTGTAAATAACAATATTTCTAATGTATTTCCCACTATTATTTATCTGCTGACATTTTGCATGTCTTTTCTACTCTGTTCAGCAGAACCCGTGGATGTCTTAAAAGTATTAGAATTTCCCACTGTCCCAGAAGGAGTAGAGAAAACGTCAGGATTCTGCACAAACCGAAGAGCATCACAGCCAGACGCGGCCTAC[A/T]AAATCAGCAAGAATGCCCAGCTCAGTGCCCCGACCAAGCAGCTTTTCCCAGGTAAGCTGAACCCCACGAACATGTCTCCATATCCTGCCTACGTTCAGCTGCGTTTAAATGTGCCCTTTGTTACGGTTGCCAAGGCTTTTGACAGGAGATGCCATCCCTGATTGTGCGGGGCCATGTTTCACTCAGACGCTTGTATTGTTAAGCGCTCGGAGAACTTGGCTGAAATCTCTTGACCGCAGCATGGCTCGTCTGCTTAGTTGCATAAGAAATGAACAAATGGTTTTAAAGAGAAAGTTCACCCACAAATAAAATAATCACCCTTATGACTTCTTTCGTTAGGGAAATGCAAAAAAAAAGATGTTTAGCAGAATGTTCATGCTGCACTTTTATGTGCAAAAAACAACTAATGACCATTCATACAAATGTAGCATTCAGCTTGTGCATTACATTCCCAGTTATCTGAATGTATCTGATACCTTCAAGATGCATGATGCCAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8893
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503 Essential Splice Site None 231 None 67
ENSDART00000042065 Essential Splice Site 262 1736 None 66
Genomic Location (Zv9):
Chromosome 24 (position 29779598)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 28777914
GRCz11 24 28857073
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGACGTCCCTCACAAGGACACACTGCAGGCACAGGAGCCCGGAGAGGAGG[T/G]CAGTAWATAGACCATGAGCCTTTTGGACTAGCTGACAGAGGAAATAGCAT
Long Flanking Sequence:
AACATGTGCTCTTTGTAGATGTGTGCATGTTTAACATGTTGTTGACCTGAAGGTTTTATGTACTGTTGCCCAACCATTGTTAGGCACATTTTATACGAGAGCAGACTTCCTTTGTGGGTTTCTGTTCCCAAGGTGTTTCGTGATGAAACATGTTTTATTTACCTGCTTATAAAGCAGCAATTTCCTGAACCTGTGTTTCTCATTGAGAAAGTTGTTGATGATTTGTTGTTTTGTTCCAACCCTGCCTTCCAGTCCTTATTTTTCTACAATGCACAGTCAATTTGATCGATTAATGTTTAATTTGTGTTAATGTTTCAGTAGTAATATTTCAGCACATGTATCTCATGTATTGCTCTGTTTTTGGTCTCCTCAGGGTGATATACAACAACTGCTGATTGTGGCTGACCCTAAAGCAGCTTACGACTACTGTGAACATTACAGCCCAGACTGTGACGTCCCTCACAAGGACACACTGCAGGCACAGGAGCCCGGAGAGGAGG[T/G]CAGTATATAGACCATGAGCCTTTTGGACTAGCTGACAGAGGAAATAGCATTTCCTTCAGTACTCAGAAGACTAAACGCTTCTGGACGTCTGACATGCTGTCGATACTTTTGACACCTACAGTCAAATGACTGGACGGACAGACTCATACTTTATTGTTGTTTTTCCACATGTTAGAATAATTGAAATAATATTATAGAATAAACTTTGAAAAACACAAACAAAAAGTGAAATATTACTGAAGTGCATGAATTATGTTGTAGCCAATAATATTACAGATAAAACTATATTGTTTTGAATGAAAAGCTTTCAAATGCATTTGTTATTAGTAGTATTGCTTTACTTGACAGATACTTTAATAGCATGTTTTCTTCATTTATTAGTATTATTAATAGTAGAACTCATCATAGTAGAAGATTTATAAACACACAAAATATTTTTAGAACTTGATGAGTGGCGAACAAATAAATTGAGATTTATTTTTGTGATTTTTAATTTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32491
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503 Essential Splice Site None 231 8 67
ENSDART00000042065 None None 1736 None 66
Genomic Location (Zv9):
Chromosome 24 (position 29771915)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 28770231
GRCz11 24 28849390
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCCCTCCATTGCTCAAACTCCCTTCCGCCGCATTGCTTTGGGTGTAATA[A/C]GGCCATGGAAGAGGAGAATTTTGGTGATTATATCACCGAGACGGCCCAGG
Long Flanking Sequence:
TTTATTTTATTTTATTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTATCCAAAAAACTAAACTCGAGAAAGCTTGTCCATTTGCTTATAAAGTAATTATAGTTTATACTGAGCTAAAAAATACCTTGTGGCTTTATGTTTAAACATTTTAAGCCATTAAATCTCCATTACTATTTCCTATTGCTGTAAATTGTACAATGTGATTTACTTAACCAAATTTAATTAACGCCTTACACTCTCTTAATCCACCTATGAATCAATGCAATTCGAATCACTTCAATGGGACAAAGAAGTGTTACCTTGTTGCCAGCCAAAATCGATGGCCATTAATCATGCAATTCATTTTGCTCTTGCTTTGCTTTAGATACAGTAGTAATTGCTTTAACTGCTAAAACTAACATCCATCTTCCCTCCATTGCTCAAACTCCCTTCCGCCGCATTGCTTTGGGTGTAATA[A/C]GGCCATGGAAGAGGAGAATTTTGGTGATTATATCACCGAGACGGCCCAGGCTGGTCTGGATCCGACCGCTGCCTCAGAAGCTGTGCTGCCCAGTGGCACCGCTGACCCCATCGGAGTGGACTCGTATGACTTTAAGGAGTATGATCTTAAGGAATATGATGTGACTGGGCTTGACAAAAATCAGTATGAGTATGGGCCTTATGATGAGTTTGGCAATGTGGCTCCAAACCCAACATCCAATTACGAGGACACTTTTGGGCCTGGGGTTGCGGCCGAAACCGACATCGCTGAAACAGACGTAAGTATTGAGCCCTGAAATGAGCGTGTCGTCCAAGCACTGGGATTGTTGGATATGGAAATCTAGCATGTGTTGTTGACTCTACAGTGTACTATTCTGCATGGGGTCTGTCCGTTTTATTCTCTCCTCTAGAATGCATTTCTTCTCTTTTATCCACATTAGTGTACTCTTTCTTTCGTCTCCATCACACTGATTCACAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44162
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503 None None 231 10 67
ENSDART00000042065 Nonsense 375 1736 9 66
Genomic Location (Zv9):
Chromosome 24 (position 29770174)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 28768490
GRCz11 24 28847649
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAATTGTGATTTTGGTGTGATTCAAAGGGAATGCTGATCGAGGGACCTT[C/A]AGGACCACCTGGACCTGCTGTAAGCAACTAGCATATTTACCTGCATCAGT
Long Flanking Sequence:
TCTATCTATCTATCTATTTGTCTATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCACCCACCCACCCACCCACCCACCCACCCACCCATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTCTGTCTGTCTGTCTGTCTGTCTGACCTGTATTGTGTGTTTTCAGCTGGGTGGAGGTGCTGCTCTTGGTCAGAAAGGTGAGAAAGGAGAGCCTGCAGTGATTGAACCAGTGAGTAAAAAGTGAATTTCTTATATGCATCAACATGGGGACGATATTAATCTGAGTTTATTACATAATTTGATCATGCAATCTGTCAGTAATTGTGATTTTGGTGTGATTCAAAGGGAATGCTGATCGAGGGACCTT[C/A]AGGACCACCTGGACCTGCTGTAAGCAACTAGCATATTTACCTGCATCAGTTTTACTGTAACATTCAGTTTTCAACCCATGTGCTCTGACCAGAAAAAAAAATCACTAAGGTCTAATCTTTTGTTATTTGGCTTATCTTTACGCTCAAACCTATGTTTGTTTGTGCTGTCTTTGTCTTTAGGGTCTTCCAGGTCCTCCAGGTTTACAAGGCCCCCCTGGTTTGGCTGGAGATCCTGGTGATAGGGTAGGACTTTTTTTTCCCTCTCTGACTTTATGCTTTATTAATATCCGATTGAGTGGTTTCAGGACATTGACATGTTTAGTTGAGATTCAGGTCTTCATCTTCTGTCATATTTCAGCTTTAGTTTGTAGAAAGTGAATTTGTTATTGTCAGGGTTAAAATATTAATCAAAAAAACTTGAGTCTGAGAAAACTGTCAGTCCTGAGAAATCCTTGCATTCTGGAAGCTTAGAAAAGGCATAGATGGCTGTTGTAAACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24520
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503 Essential Splice Site None 231 None 67
ENSDART00000042065 Essential Splice Site 528 1736 None 66
Genomic Location (Zv9):
Chromosome 24 (position 29759750)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 28758066
GRCz11 24 28837225
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGGAGCTGATGGTGCCCGAGGAATGCCTGGAGAGTCTGGATCTAAGG[T/A]ATGGAAAATGTTTATTTGACCTTTTCATGCTCACATATAAGTTATGCTGT
Long Flanking Sequence:
TACACCAAGATAATGGGGACATTACCTATGTCTGCCAGAAAAGGAGAAATTGACTCAAAATCAGTCTGATTATCTTGTGGTGTGTGTCCTGTTCTTCCCCATGAGCGTTTGAGTGTATGGTTAAAAACTAGCTTAGAGGGTTATCTGCTGTCAAAAACAAAGCCCAGCATCTTATCAAGAGTGAATAGAGATGCAGTTAGAAAATCTCAGAATAGATTTAGAATTGATATCTTGAACATTTTTCCCCCCTCAGCTCTAATGTTAGCCTATCCACGGAAGCATATGTAAAAGAGAGCTCAGAATTTGCCCACTAAAAGAAAGATGGCATTGTTTCAGATATATTTTATTATCAAAACATTACCTAAATATGAATACTTTTGACAACAATAGTTTGGTCACATAATAGTTCTCAAAAATAGTATAATGCCTGATTGATGTGTGACAGGGTCGTGCTGGAGCTGATGGTGCCCGAGGAATGCCTGGAGAGTCTGGATCTAAGG[T/A]ATGGAAAATGTTTATTTGACCTTTTCATGCTCACATATAAGTTATGCTGTACTGCTTAACATATTGCTTGATTATCTTACTTGGTCATCTTCAAAGGGTGACAGAGGTTTCGATGGGCTTCCGGGTCTGCCTGGTGAGAAAGGACACAGGGTGAGTAAACAATTGCAAGTAGATGCAAGTTGGTGATAATTAATTAGTTTTTGCTGAAGACACAAAGTATTGAGTGATTTAATTTGGCACAGCAAACAATAAAGAAACTCAATCTAATAAGGAATTTAGTTATTAAATGTCTAAATATATTAAAAGGAATTTGCATAAAGACACTACAATATATGTATGTTCTTAAACAGGGGTTTTCAACCTTTTATATGATTTCAGATGATCCTAATTTCTAAATTGTTTTCAGGCACAATCCTTGTATGAGTTTAGAAAGAAAATGTGTTCTTATTTATTTGTATTGTTACTACTAATGCGTTGACTATTATTTATTCCTCCAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39459
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503 Essential Splice Site None 231 None 67
ENSDART00000042065 Essential Splice Site 579 1736 None 66
Genomic Location (Zv9):
Chromosome 24 (position 29757764)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 28756080
GRCz11 24 28835239
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGGGAGAAGATGGTGAGATCGGACCAAGAGGACTTGCTGGTGAGAGCG[T/C]AAGTGTGTCTTGCATTGACTAAATGCTTTATTTCTTGTTGGCCACCAGGG
Long Flanking Sequence:
CATTCAAATTGATTCATGAAAATGGTAAAAAATTTGCAAGGAAGTTACAGGATTAGTTACAAGGAGGTAAAACTTGCAGCATTTAGAAATTATGCTCTTCATTGTAGTAATATATAATACATTATAAATCCGAGAAGAATAATGAGCTCTTCAAAGGTGAAATTATTCATTAAAAGTCAGATATTTCCTTTCGGTTCCCATGTCAACACAGGTAATAATTACAGGATTCAAAATTACTCCGTAGATCAGAGATATAAAGCAAGGATTTTATATTAAGTCGAATGTAATAAAGAATGATGCTTCCTCTCTTTTTTGAAAGGGTGAGACCGGCCCTGCTGGACCCCCGGGACCAACTGGAGAGGATGGACCAAGAGTAAATTTTTTTTTCATTCACCTTCTCTCAATATATTGGTTCACTCACTAGAAAAAAAAGTAACTTCTTTCTTCTTTACAGGGAGAAGATGGTGAGATCGGACCAAGAGGACTTGCTGGTGAGAGCG[T/C]AAGTGTGTCTTGCATTGACTAAATGCTTTATTTCTTGTTGGCCACCAGGGGGCAGAATCTCCCAAAAGCCTATTAGTATTCCTATTAAAATTCAGATAAGAGAACTTGCACATTTTAATCAAAGCCTTTTTATCTCAGGGGCCGCGAGGTCTTCTCGGCCCAAGAGGCCCTCCTGGACCTCCTGGACAACCTGTGAGTGTGTTTTTAATGTGTAATCTGCAAATCTGAAGCTGATTGCTCTCTTCTAATCTTGCGCAATTGATTTCTGCAGGGCATTGCTGGTGTTGATGGTCCGCAGGGTCCCAAAGGAAACATGGTAAGAGACATGGATCTCTAAAACATGGCATTTTGTAGATAAAGTCATGCTGATAATACTTGTTGAGTCAATCACCGTGGGTTCTGCACATATTTGTTCAATACCAATATAAAGCTGTATAATGGGAGGTTTAAGGTGAGACCCTAAAGGCAAGAAAGATTTTTCATGCATCTGACATTTTAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30116
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503 None None 231 47 67
ENSDART00000042065 Nonsense 1139 1736 46 66
Genomic Location (Zv9):
Chromosome 24 (position 29719916)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 28718232
GRCz11 24 28797391
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTAAACATAATATCCATTTTTTAACAGGGTCTTCCAGGACCACCTGGC[G/T]AGAAAGGTGAAAATGGAGATGTTGGTCCTATGGTAAGTATTTGAACCATA
Long Flanking Sequence:
GGAGAAATATATTTGGATAGACAAGTTTCTATGCTAGTAAAATAGCTTTCATATTGAACTCAGTGTTAAAAGTCCTCTACGTTTTTTTACCCCTCACTTTTCTCTGGCTATATGAAAAGGTGACAAACAATATAGTGTTCGTGGGAAACATGAGCTACAAATCTGACAAAGTTTATTAGCTGCTCTCTTAGATTGCAAGATGACAGAGAGTGAAACTCAATAAACGCTCCGCACTCCGCCTCTGCCTCTTCCATTTGCCATATGGCCCCTTTGCCTTTCTCCGCCAATTCTGAAATGAAGCATTATTGCTGTCCTCCGGTAACTGCGTCTGAGCCAGATTATTTTTCTCTTTTCATCAGAGGGTCCATTTTGTGGTGCCTCACAGCAACAGTGTGTCTATGAACATTTTGTTGTTTTAGTCAGTATACTATAGTATATGAGTGTATGGCTATTTAAACATAATATCCATTTTTTAACAGGGTCTTCCAGGACCACCTGGC[G/T]AGAAAGGTGAAAATGGAGATGTTGGTCCTATGGTAAGTATTTGAACCATATATTTTTAACTTATTTAAATTTCTGTTTAATGTTTTGACCTATAGTTATAAATCTAATTGTATTTGTCTATTCACAGGGTCCTCCTGGTCCACCAGGTCCCAGAGGACCTCAGGGTCCTCCTGGTGCTGATGTAAGAGCATTTGTCAACATTGAACACCATTAGCGAATCCTTTAATATACATCACTTTGTTTAACTGGATTGCTTTAGTGTTAATGGTTTCCACATATGGTTCTTAACGAATCGACATCTTTTATTGAAGGGCCCGCAAGGTCCTCCTGGTGGAATAGGAGGAATGGGAGCCGTGGGTGAGAAGGTAATTGTATTCCCAGTGTTTATACCCTAAATATATGGCATACATGGTCAAATTTCAAATCTGAGATGTATTCGTTCATATTGTGTGTATTTTTATGTCTGATTTAATATAACAAAACGATTAAAGGCTACATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11965
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503 Essential Splice Site None 231 None 67
ENSDART00000042065 Essential Splice Site 1258 1736 None 66
Genomic Location (Zv9):
Chromosome 24 (position 29717060)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 28715376
GRCz11 24 28794535
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATTGTCAAGTTNNNNNNNNNNNNNNNNNCTGTNNNNATCTAAAATCCTC[A/T]GGGAATAGATGGAGGCCCAGGAGAGAAGGGAGAGGATGGAGAGTCTGGTC
Long Flanking Sequence:
GGGTGCTCCGGTTTCCCCAACAGTCCAAAGACATGCACTATAGATAAATAGCCAAATTGAATAAACTAAATTGGTTGTATGTGTATGAATGTGAGAGTGTATGGGCATTTCACAGTACTGGGTTGCGGCTGGAAGGGCATCCACTGCATAATACATATGCTGGATAAGTTGGCGGTTCATTCCGCTGTGGCGACCCCTGATAGATAAAGGGACCAAGCTGAAGAAAAATGAATGAATGCATGAAGATGCCAGTCTGTTAAATTGTGTGTTCAATCTTTTTTTCTATAGGGCCCTGTTGGTTTTCCTGGAGACCCAGGTCCACCTGGTGAGCCAGGTGTTGCTGTAAGTGCCGAAATCCATCAATTAAACAACTGTAACTTACTTTTCTATAAATAACTTTTCCATGTACAAACACCTTGTAACTAGATAAAGACATTTGCTTATTTTGTCAATTGTCAAGTTATTTGCCTCTAAAATATCTGTTTGTATCTAAAATCCTC[A/T]GGGAATAGATGGAGGCCCAGGAGAGAAGGGAGAGGATGGAGAGTCTGGTCAGCCTGTGAGTATTAACAGCATTTCGAGGCCATGCTTTTGACTACAGTTTATAATTTCCTGCGCTATGCATACTTAGTCATTTAATTCAGGCAACAATTAACTAAAATATAACTATTTAAATTGTTTATTTGCCATTGCATAAGTATATGTACATGCACAGTGCAGAAAGATTAATAAATGGTGATTGGATATAGGGAAGTCAAATATAATTGACTGAGCCTACAGTGGCAGCTCATAAATTGCAGTCCTTATTAACATTTATTATAGTAATTTGAATTTTCCACTGCAGGGAAATTGGTTAATTTACCATTAAATTCAGTGTATCGGAACTCCAGGTTTGCAAATGTGAACATCTAGCATTGGGAGTCTCTCTGCAAGGCCCATTGATAAGCTACAACTCTCCATGAAAGTTTAATGAGGGGAGATTTGTTTACAGCAGCAAACTTTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4271
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503 Essential Splice Site 105 231 65 67
ENSDART00000042065 Essential Splice Site 1610 1736 64 66
Genomic Location (Zv9):
Chromosome 24 (position 29693441)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 28691757
GRCz11 24 28770916
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAAAGAGGTGCCCGGCTCCTGGTTCAGTGAATTTAAGCGTGGCAAAATA[G/A]TAAGTGCACTTCCCCGTCTTTCTTTCATCTTCTCCTTTATGAAAAACATC
Long Flanking Sequence:
ATATAAGTTGTCATCTTTTGATTTCTGATATTGGAGTAAAATATATATGTCTGTTTTGACTAAAGATTTACTTCTCACAATATTGCAACTTTTTTTACCTGAAATGTTTTGTCTTTCAACAGTCTCATCTTGTAATGTTCATCTGTGCATTCAGATCTGAAAGAACAAAAACAGATTAAAATTAGATCAAAAGCTCATTCCCAGTATTAAAATAATCTGCTTCGCTCATGCTGCGTTAAACAAAGCCATAATTTCAGAGAGATGCATTTTCATTTCATTCCAATCGTTGGAACAGATGCTGTATGGAAAAAAAATAGGCTTTAATTTTATTTAATGTTCTGCTGAAGCAAGAATGCCGTGCATACAAAACCACACACACAGCTGCTCTTTTGCCATTATGTTTTCACATTTTTCTTTGTCTCTTCTTTAAGGTGAGAATATCTTCATGGCCCAAAGAGGTGCCCGGCTCCTGGTTCAGTGAATTTAAGCGTGGCAAAATA[G/A]TAAGTGCACTTCCCCGTCTTTCTTTCATCTTCTCCTTTATGAAAAACATCATCTTGTCCTTGGAATCTAAAAGGACCTGAGTGGTCTGCTCCGTCTTTTTTCTTTACTTCACCAATGGACAGACACCAGTAAGAGCTCGGCTTTTAAAAGATGCTGTCACTGCAGCCCTGCATCCATCAACAAACTGAACACACACATACATATACGTACACTGTAAAGCATCTCTGAGCCCTGGAAAGGGGCTGTATATATATATAGAACGTACTATGGTAAAACTTTAGTTTAAGTAAAACTTCACACCATTGACTACTAGTTCATTACCTATAAGACATTAACTGTTTATTAGAACTTATTAAGTATGATCTTCTTTTACATCCTAGCCAACAGCTAAATCCAGCTAATACCTTACTAACCACACTCAATGGCCACTTTATTAGGTACATCTTACTAGTAGTAAGTTGGACCCTGGCTTGTCTTCAGAACTGCCTTAATCCTTCATG
Associated Phenotype:
Not determined