Busch Lab

ZMP

slc46a1

Ensembl ID:
ENSDARG00000026149
ZFIN ID:
ZDB-GENE-040426-1012
Description:
Proton-coupled folate transporter [Source:UniProtKB/Swiss-Prot;Acc:Q7ZWG6]
Human Orthologue:
SLC46A1
Human Description:
solute carrier family 46 (folate transporter), member 1 [Source:HGNC Symbol;Acc:30521]
Mouse Orthologue:
Slc46a1
Mouse Description:
solute carrier family 46, member 1 Gene [Source:MGI Symbol;Acc:MGI:1098733]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa32038 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32038
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037119 Nonsense 221 481 2 6
Genomic Location (Zv9):
Chromosome 15 (position 27527223)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28245463
GRCz11 15 28178339
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGAGGCTTGCCTGGGATTGGCTGGCATGTTTGCAAGCATCATTGGAGGA[C/T]AGTGGAGACGGGCCCAAGGGTATTTCATTTTTTCTTCTAAATTGGAATCT
Long Flanking Sequence:
CAAAATTCTGTAAGTTGCCACAAGTAATATAAACAGTTACCACTTCTCTGTCAAAACTCAATAAAGCATCTGTTGACATCCTTCTGTGTCATTTGGTGCAATTCTTACGGTTTTATTTTATTTTCAAGGAAGTGGAGACTCTGACTGCACACTGGAGCCTGTACATCAATTTAGGCGGCTTTCTAGTTGGACTGTTTATGGTGATCCTGCTGGGCTCATGGAGTGACCGTGCGGGCCGGCGTCTGGTTCTGATCATTCCTTCTCTTGGCCTGGCCGTTCAGGCAGCTGTGTATCTGACAGTAATGTACCTGAAGCTGCCCGTGTTCTGGTTCCTCATTGGGAGGATCTGCAGTGGCCTCTCAGGGGACTTCAATGCTATATTGGCTGGTTGCTTTGCATATGTGGCTGACACGAGTGAAAGGGGCTCTCGCACTTTTCGTGTGGCCATACTAGAGGCTTGCCTGGGATTGGCTGGCATGTTTGCAAGCATCATTGGAGGA[C/T]AGTGGAGACGGGCCCAAGGGTATTTCATTTTTTCTTCTAAATTGGAATCTTTCTAAACTCAACCAAAACATAGCTGGATTGCACCCTTCGCCATGTCATCTTTAACTCCCCCATCTTCTGCCATTAAATTTTCTACTTGCTGTTTCACTTTCACTTTTAAAATTGGCTTATAATTAAAGGTCTTGTGAAATTAAAATAAAATAAATTGAGGTGCTATTTTCAGTCTGTTAGTTTTGAGGATATAAATAATTTAGTGGGCAAAAACTTAACAAAATTCACATTTAGAAAATTTAAAACTGATATAAGCAAAGCTTGCAGTTTATCACTTCCGTCTAAATTAAACCAACATTTTTTCACCTCACCTCATACCTCAGTTTCTCATCAAATCTCAACCAATCAAATGCTCTCTAGTATCTGACATGTCCCGCCCCCTTCAAGACGCATTCTATCAATCACTTGCACTGGCAGAACTGTGATAAAAACGAAACGCTATTGGCTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28468
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037119 Essential Splice Site 227 481 2 6
Genomic Location (Zv9):
Chromosome 15 (position 27527244)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28245484
GRCz11 15 28178360
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGCATGTTTGCAAGCATCATTGGAGGACAGTGGAGACGGGCCCAAGGG[T/G]ATTTCATTTTTTCTTCTAAATTGGAATCTTTCTAAACTCAACCAAAACAT
Long Flanking Sequence:
AAGTAATATAAACAGTTACCACTTCTCTGTCAAAACTCAATAAAGCATCTGTTGACATCCTTCTGTGTCATTTGGTGCAATTCTTACGGTTTTATTTTATTTTCAAGGAAGTGGAGACTCTGACTGCACACTGGAGCCTGTACATCAATTTAGGCGGCTTTCTAGTTGGACTGTTTATGGTGATCCTGCTGGGCTCATGGAGTGACCGTGCGGGCCGGCGTCTGGTTCTGATCATTCCTTCTCTTGGCCTGGCCGTTCAGGCAGCTGTGTATCTGACAGTAATGTACCTGAAGCTGCCCGTGTTCTGGTTCCTCATTGGGAGGATCTGCAGTGGCCTCTCAGGGGACTTCAATGCTATATTGGCTGGTTGCTTTGCATATGTGGCTGACACGAGTGAAAGGGGCTCTCGCACTTTTCGTGTGGCCATACTAGAGGCTTGCCTGGGATTGGCTGGCATGTTTGCAAGCATCATTGGAGGACAGTGGAGACGGGCCCAAGGG[T/G]ATTTCATTTTTTCTTCTAAATTGGAATCTTTCTAAACTCAACCAAAACATAGCTGGATTGCACCCTTCGCCATGTCATCTTTAACTCCCCCATCTTCTGCCATTAAATTTTCTACTTGCTGTTTCACTTTCACTTTTAAAATTGGCTTATAATTAAAGGTCTTGTGAAATTAAAATAAAATAAATTGAGGTGCTATTTTCAGTCTGTTAGTTTTGAGGATATAAATAATTTAGTGGGCAAAAACTTAACAAAATTCACATTTAGAAAATTTAAAACTGATATAAGCAAAGCTTGCAGTTTATCACTTCCGTCTAAATTAAACCAACATTTTTTCACCTCACCTCATACCTCAGTTTCTCATCAAATCTCAACCAATCAAATGCTCTCTAGTATCTGACATGTCCCGCCCCCTTCAAGACGCATTCTATCAATCACTTGCACTGGCAGAACTGTGATAAAAACGAAACGCTATTGGCTTTTTTTTAAAGGGGAGGAGCTAC
Associated Phenotype:
Not determined