Busch Lab

ZMP

lhcgr

Ensembl ID:
ENSDARG00000026081
ZFIN ID:
ZDB-GENE-040806-3
Description:
lutropin-choriogonadotropic hormone receptor [Source:RefSeq peptide;Acc:NP_991188]
Human Orthologue:
LHCGR
Human Description:
luteinizing hormone/choriogonadotropin receptor [Source:HGNC Symbol;Acc:6585]
Mouse Orthologue:
Lhcgr
Mouse Description:
luteinizing hormone/choriogonadotropin receptor Gene [Source:MGI Symbol;Acc:MGI:96783]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22377 Nonsense Available for shipment Available now
sa35588 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22377
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097459 Nonsense 54 708 2 11
Genomic Location (Zv9):
Chromosome 13 (position 48049153)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 47300139
GRCz11 13 47589964
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATGCAGCCTAATTATTAATATATCTTGTGATTTCAGAGTTTTGAACTA[C/A]ATCTCAGTGAAGACCATCAGCAGCCGGAGTTTCGACGGCCTGAAAGGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35588
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097459 Nonsense 684 708 11 11
Genomic Location (Zv9):
Chromosome 13 (position 48077361)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 47328347
GRCz11 13 47618172
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCGGAGAACATCAACCGAAGCAAAAGCAGCTCCGGCTCCAATGCGAACT[C/A]GAAAGGGCCTCGAGCCGTCATGTGGATGTCAAGCTTTCCTCAGTTAACAC
Associated Phenotype:
Not determined