Busch Lab

ZMP

ankrd44

Ensembl ID:
ENSDARG00000026028
ZFIN ID:
ZDB-GENE-070912-605
Human Orthologue:
ANKRD44
Human Description:
ankyrin repeat domain 44 [Source:HGNC Symbol;Acc:25259]
Mouse Orthologues:
Ankrd44, E230028L10Rik
Mouse Descriptions:
RIKEN cDNA E230028L10 gene Gene [Source:MGI Symbol;Acc:MGI:2685285]
ankyrin repeat domain 44 Gene [Source:MGI Symbol;Acc:MGI:3045243]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa25429 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15884 Essential Splice Site Available for shipment Available now
sa34678 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6117 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25429
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037182 Essential Splice Site 9 1050 1 28
ENSDART00000142768 None None 1037 None 26
Genomic Location (Zv9):
Chromosome 9 (position 33191569)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32347515
GRCz11 9 32158261
KASP Assay ID:
554-7435.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGATGTCCAGTTTCACATGATATGGCTGTTCTCAAACTAGTCGACCAG[G/A]TAATTTACTAAGATTTTTTAAAATGTTTATAAAAATGAAGTTGACTTGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27425
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037182 Nonsense 74 1050 4 28
ENSDART00000142768 Nonsense 65 1037 3 26
Genomic Location (Zv9):
Chromosome 9 (position 33173034)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32328980
GRCz11 9 32139726
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTACTACCTCATTTTAGGTGCACGGGTCAATGCCAAAGACAATATGTG[G/A]TTGACTCCACTCCACAGGGCAGTGGCATCACGTAGCGAGGTGGGGACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15884
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037182 None None 1050 None 28
ENSDART00000142768 Essential Splice Site 386 1037 11 26
Genomic Location (Zv9):
Chromosome 9 (position 33166590)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32322536
GRCz11 9 32133282
KASP Assay ID:
2260-2022.1 (used for ordering genotyping assays)
KASP Sequence:
TCCTCTTCTGTGCACTGTATCCTTCCTCCTCATCCTTCCATTCCTCTACA[G/A]GACGGAGGTATAGCATAATGTGYCCTCTCAGTAATGACTCGGTCCTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34678
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037182 Essential Splice Site 486 1050 14 28
ENSDART00000142768 Essential Splice Site 495 1037 13 26
Genomic Location (Zv9):
Chromosome 9 (position 33163946)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32319892
GRCz11 9 32130638
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGGGCGCACTGCTGTTCACTACGCTGCTGCTTCCGACCTGGACAGAAG[G/A]TACGTGCATCATTAAACAAGGATTACTCTCATAATTGGTAAAAATAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6117
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037182 Nonsense 590 1050 18 28
ENSDART00000142768 Nonsense 577 1037 16 26
Genomic Location (Zv9):
Chromosome 9 (position 33153234)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32309180
GRCz11 9 32119926
KASP Assay ID:
554-3656.1 (used for ordering genotyping assays)
KASP Sequence:
GGCACGCGCAGGCTCTAGAAGTGCTCTTGGAGGGTCACTGTGAGGTGGAT[C/T]AGGGGGATGAAGTTGRTCGGACTCCACTGGCCCTTGCTGCTCTCAGGGGC
Associated Phenotype:
Not determined