Busch Lab

ZMP

TIAM1 (1 of 2)

Ensembl ID:
ENSDARG00000025920
Description:
T-cell lymphoma invasion and metastasis 1 [Source:HGNC Symbol;Acc:11805]
Human Orthologue:
TIAM1
Human Description:
T-cell lymphoma invasion and metastasis 1 [Source:HGNC Symbol;Acc:11805]
Mouse Orthologue:
Tiam1
Mouse Description:
T-cell lymphoma invasion and metastasis 1 Gene [Source:MGI Symbol;Acc:MGI:103306]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa35986 Nonsense Mutation detected in F1 DNA Not yet available
sa28533 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32061 Nonsense Available for shipment Available now
sa44834 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10824 Essential Splice Site Available for shipment Available now
sa24996 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35986
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089694 Nonsense 13 1562 1 27
Genomic Location (Zv9):
Chromosome 15 (position 40961487)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 42477883
GRCz11 15 42434235
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATTTTGAGTCATGGGTAATGCAGAGAGTCACAGCGGTGGCCATGGCTA[T/A]TATGGAGACGGTCAGCGGCAACTGTCTCGAAAACACATGTCCCGCTCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28533
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089694 Essential Splice Site 261 1562 2 27
Genomic Location (Zv9):
Chromosome 15 (position 40964417)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 42480813
GRCz11 15 42437165
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCAATCAGCAGGGGGTTATGCAAGGGAGGCGGGCACAAACCATACAGG[T/C]GAGGTTCTTATTGGGTGACCATTCCTAGAGTGAAGTCTTATTGGTCCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32061
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089694 Nonsense 1127 1562 20 27
Genomic Location (Zv9):
Chromosome 15 (position 41066543)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 42581793
GRCz11 15 42538145
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTGTTTCCTCCAGCGAAGACAGACGCAGCCTTCAAGGCCTTTCTGGAT[G/T]AACGTAACCCCAAACAGCAGCATTCGTCCACGCTGGAGTCATACCTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44834
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089694 Essential Splice Site 1175 1562 20 27
Genomic Location (Zv9):
Chromosome 15 (position 41066689)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 42581939
GRCz11 15 42538291
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTACACTCGCTCACTGACCCTGACAGCGAAGAGCACTACCACCTCAACGG[T/G]CAGCTTAAGCATATATCTAATCTAATGCGCATTAATATACAGGGTTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10824
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089694 Essential Splice Site 1175 1562 21 27
Genomic Location (Zv9):
Chromosome 15 (position 41068898)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 42584147
GRCz11 15 42540499
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGCTCATGATACCTGACTGCTATTTGATCTCTCCTCTCTGCTGTGTGCA[G/A]TTGCAATGAAAGCCATGAACACAGTGGCCAGCCACATCAATGAGATGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24996
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089694 Nonsense 1547 1562 27 27
Genomic Location (Zv9):
Chromosome 15 (position 41079508)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 42594754
GRCz11 15 42551106
KASP Assay ID:
554-7794.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTGGCCAGCGTTGACGAGCAAGCGACATCTGATGATGTTGTCTGGGTG[C/T]GACGGGACAGCGGTGCAGAGAACGAGACACAGGACGAAAGCCAGAGCTGA
Associated Phenotype:
Not determined