Busch Lab

ZMP

usp14

Ensembl ID:
ENSDARG00000025889
ZFIN ID:
ZDB-GENE-030131-7676
Description:
ubiquitin carboxyl-terminal hydrolase 14 [Source:RefSeq peptide;Acc:NP_956267]
Human Orthologue:
USP14
Human Description:
ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase) [Source:HGNC Symbol;Acc:12612]
Mouse Orthologue:
Usp14
Mouse Description:
ubiquitin specific peptidase 14 Gene [Source:MGI Symbol;Acc:MGI:1928898]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa19655 Nonsense Available for shipment Available now
sa19654 Nonsense Available for shipment Available now
sa15236 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19655
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032540 Nonsense 30 489 2 16
Genomic Location (Zv9):
Chromosome 2 (position 2960305)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2967330
GRCz11 2 2809229
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAGTTTGATGCGGTGGAGCTGAACACAGAGGAGCCGCCCATGGTGTTC[A/T]AAGCCCAGCTGTTCGCTCTAACAGGAGTTCAGCCAGAGAGACAGAAAGTC
Long Flanking Sequence:
AAAGTTGAGTAAATGATGATTAAATTGCCATTTATTTGAGTTTATTTAATTAAAATTAATTTCTTTCATATATGCAAAATGTCGACAGGATATTAAAGAGTGGTCAAACTTAGTTTATATACGTAGTCTGTGTCCAAATGCTTTAAATTATCTTGAAATGCCTTTAAAACACATGCAAATATAAAGATGTTGTGGTTTTACTTTGCAATGACACCACAAATCCCATCTGTACTCAATTGAAGTGCTAATCAACTATAATCCCTCAACATTGCGATATTGATGCTGAAACGCTGTGTTGTGCAGCCCAAATATGAATCCATTTTTTTGTAGAGCCATCGGCTATTTGCAAATATGTGGACTGGCACTGAATTAAACTTTGCTGCGTCACTAATGCATGTCTGTTTTTAATTTATTTCTGTAATATCACAGTGAATGTGAAATGGGGAAAGGAGAAGTTTGATGCGGTGGAGCTGAACACAGAGGAGCCGCCCATGGTGTTC[A/T]AAGCCCAGCTGTTCGCTCTAACAGGAGTTCAGCCAGAGAGACAGAAAGTCATGGTGAAAGGCGGGACACTGAAGGTATAAAGCCGCCACTGAGAGTATTACTGTTAATTGGCTTCCTCTGTTATTGCGAGTGTGTGACTTCTTTTACTTTTGTTCTCCAGGATGATGAGTGGGGCAATATCAAGTTGAAAAATGTGAGTATGTTGCTATAAATACTTTCTATTCAAGTTCAAGAGCTCAGATTGCAAACGTTAATAGGTAAAGGGAGCCAGAAATGAAAATGTACTCACTCTAAAGTGGTTCCAAACCTTTATCAGTTCCTTTGTTTTGTTGAACACAAAAGAAGATATTTTGAAGAATGCTGAAAACCGATAACCTTTGGGTTGAAGCTATAAATTGAGCTCAGGTACATTCTGTTTCCACGGATCATTCTTGAAATGTTTCAGCAGCTTCATTGGAGTTCACCTGTGCTTAATTCAGTTGATTGGACATGATTTGAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25743
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032540 Nonsense 332 489 12 16
Genomic Location (Zv9):
Chromosome 2 (position 2946649)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2953674
GRCz11 2 2795573
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCAGCCGTCTCCCGGCGTACCTCACAGTTCAGATGGTCCGGTTCTTTTA[T/A]AAGGAAAAGGAGTCTGTGAATGCCAAAGTACTAAAGGTAGGACATTTACT
Long Flanking Sequence:
GCCCAATGCAAACAACCCCTAACATCTTTATTCTGGGCTTACCACCCTAAATTAATTCTCTTGCATAAAGTAAATCGTATCCCGAAGCTTTTACTGGGGCACAGTTAATTGATACTGGGGCACTTTTATTTATTTATTTATTTTTTTGCACTTCTCCGCGTGCCGCCCCAGCAAGATGCCGCCCTGGGTGTTCTTCGCCCATTTTGCCCATGTCTAAATCTGCCATTGAGCCTATCCATGCCACCAAACCCGTCCCTAACCCTACCCATATCCCATCTCTGAAGCACCTGAAGTGTCCTGCAATACATTATTAAGTGATTGTACTTCTTTTTTGATGCAAGTACATAATTATTAAGGCCGCCTAAAATAAAGTGGGGCAGAAAGTTTTTGAGATTTTTATTTTGTTGTGTGACGTTGAAATAAAGTCCTGTTTCTATTTTTCAGTCCAAAATCAGCCGTCTCCCGGCGTACCTCACAGTTCAGATGGTCCGGTTCTTTTA[T/A]AAGGAAAAGGAGTCTGTGAATGCCAAAGTACTAAAGGTAGGACATTTACTCTAGATTGAGTTGGCGGTTTGACCTAAATTGGTTGAACATTTTACCTCGATTACGATTAATGAAGGATTATTTGATTTATTTGTTAATTTTTTTTTGCTCTCCTAGTTCACTAAGTTTTGTAAAGTAAATATGCACACATATTACAAGTGAGAGATTTCTGAATGAAGGGTGCGTTACTTGATTTAAAAATAATTTAAGGAAACACACACAAACACACACACTACCTACTGTCTATGATTATTCATTGAACGTCAACGTTGAACAACTGAAATTAAAACACACATTGCCTAAAACCAACAGTCACTTTTTTATTCTTGGAGAGTGCACTTTTGCAAACAAAATTCATATTACAAGTAAAAAATAAAAATAACTCGTATTTAATATTTAAAACAGTGCCTTTCATGCATCTTCTGTAAACAAATATTTTAAAGGAGATAATTATTTTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19654
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032540 Nonsense 401 489 14 16
Genomic Location (Zv9):
Chromosome 2 (position 2943928)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2950953
GRCz11 2 2792852
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCTTCAACAGCCGAATAAGAAGCCTGGTGCTCTAAAGGAGACAAAATA[T/G]GAACCTTTTAGTTTTCCCGATGGTAAGTGCTTAATGCAGAGGATCAAGAG
Long Flanking Sequence:
AGAAGGAAAATCAAGCACGGTGGCTTTTCCTACCACACCAACTAAATTTTCCTTTCTGATATTTGTCTCCAGTTTATCAGGACATGCCCATTTTATTCTCTTTGACTCATTAGATGGAAACGCTGCTTTATGCGCATATTTTTTTTTTGCAATATTCCAGCTTTGCCCATTAATAAAATTAGCATCTTTAAATGGACCCAGCTACTGATTCAATGAACTCTTTTCTTCTCTGATCATTTGCATATGTCTGCGTCAGGATGTCAAGTTTCCTCTTATGCTGGACGTGTACGAGCTGTGCACATCTGAGCTGCAGGAGAAGATGGTTTCTCTGAGGTCCAAGTTTAAGGAGATGGAGGACAAGAAACTGGAGAAGCAACAGCAGTCTGAAGCAAGTGATCGCAATTCAAGCATTGTTTTAAAATCCTTCTAGGAAGTCAATAACATTTTCTTGTTCTTCAACAGCCGAATAAGAAGCCTGGTGCTCTAAAGGAGACAAAATA[T/G]GAACCTTTTAGTTTTCCCGATGGTAAGTGCTTAATGCAGAGGATCAAGAGTGTTTTCATGTCGCTTCTGAAACGGGAAATAATAATATATAAACGTCTCTCCATAGACTTGGGCTCCAACAACAGTGGCTACTATGAACTGCAAGCTGTTCTGACGCATCAGGGCCGATCCAGCTCATCTGGCCATTATGTCGCCTGGGTTAAAAGGAAAGAAGGTCAAGTATCAACAATATCTATTGAACACTCAATTCGTGTTTATTAGCCTCATTAATTATAGAGAGAAACATGTCACCCTTTTCATGGCCCTTTAAAGGGCCATGAAACCCCCTCGTTTCAGCAGGGTGTTTTCACACCTCTACTTTGGAAAAAGCCAGAAAAGTGGGCGTGTCCAGCTCTGTTTAGGGGGGAGTGTCGGAGGACGAAAAGAGGCACGGTGTGGGAGTGTCTATTTGGGCACGCGACTGTGTTTACATGGGCATCTGTAGTCGAATTATTTGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15236
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032540 Nonsense 441 489 15 16
Genomic Location (Zv9):
Chromosome 2 (position 2943726)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2950751
GRCz11 2 2792650
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGACGCATCAGGGCCGATCCAGCTCATCTGGCCATTATGTCKCCTGGGTT[A/T]AAAGGAAAGAAGGTCAAGTATCAACAATATCTATTGAACACTCAAKTYGT
Long Flanking Sequence:
TACTGATTCAATGAACTCTTTTCTTCTCTGATCATTTGCATATGTCTGCGTCAGGATGTCAAGTTTCCTCTTATGCTGGACGTGTACGAGCTGTGCACATCTGAGCTGCAGGAGAAGATGGTTTCTCTGAGGTCCAAGTTTAAGGAGATGGAGGACAAGAAACTGGAGAAGCAACAGCAGTCTGAAGCAAGTGATCGCAATTCAAGCATTGTTTTAAAATCCTTCTAGGAAGTCAATAACATTTTCTTGTTCTTCAACAGCCGAATAAGAAGCCTGGTGCTCTAAAGGAGACAAAATATGAACCTTTTAGTTTTCCCGATGGTAAGTGCTTAATGCAGAGGATCAAGAGTGTTTTCATGTCGCTTCTGAAACGGGAAATAATAATATATAAACGTCTCTCCATAGACTTGGGCTCCAACAACAGTGGCTACTATGAACTGCAAGCTGTTCTGACGCATCAGGGCCGATCCAGCTCATCTGGCCATTATGTCGCCTGGGTT[A/T]AAAGGAAAGAAGGTCAAGTATCAACAATATCTATTGAACACTCAATTCGTGTTTATTAGCCTCATTAATTATAGAGAGAAACATGTCACCCTTTTCATGGCCCTTTAAAGGGCCATGAAACCCCCTCGTTTCAGCAGGGTGTTTTCACACCTCTACTTTGGAAAAAGCCAGAAAAGTGGGCGTGTCCAGCTCTGTTTAGGGGGGAGTGTCGGAGGACGAAAAGAGGCACGGTGTGGGAGTGTCTATTTGGGCACGCGACTGTGTTTACATGGGCATCTGTAGTCGAATTATTTGTCAAATTATTAAATGTTGGACTTTAACTGCAGTTTGGCTCTTTCATTCAGGGAATTCATTCATGTCCCTCGCGACAAACGAGATATTTGATTCGAGGAACTGCTCTAAGCGTGTATTTTTCATGCAATGTTTGATACCGCACGGCGAATGAGAGAAAAAAACCTCCGCATTTCCCAGAAACTTAGATGCACACGGCAGGTAGCGTC
Associated Phenotype:
Not determined