Busch Lab

ZMP

zgc:153278

Ensembl ID:
ENSDARG00000025875
ZFIN ID:
ZDB-GENE-060825-85
Description:
BTB/POZ domain-containing protein KCTD2 [Source:RefSeq peptide;Acc:NP_001038899]
Human Orthologue:
KCTD2
Human Description:
potassium channel tetramerisation domain containing 2 [Source:HGNC Symbol;Acc:21294]
Mouse Orthologue:
Kctd2
Mouse Description:
potassium channel tetramerisation domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917632]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa9248 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2674
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035925 Nonsense 107 267 1 6
Genomic Location (Zv9):
Chromosome 12 (position 28179805)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26517414
GRCz11 12 26608774
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCAAACAGACCCTTTGCAGGGATCCCAAATCATTTCTGTATCGATTGTG[T/A]CAGGAAGATCCAGATCTGGATTCGGACAAGGTAACGTTAAGGCTCGGTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27956
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035925 Essential Splice Site 117 267 1 6
Genomic Location (Zv9):
Chromosome 12 (position 28179774)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26517383
GRCz11 12 26608743
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTTCTGTATCGATTGTGTCAGGAAGATCCAGATCTGGATTCGGACAAG[G/A]TAACGTTAAGGCTCGGTTTACATCACCAAAGCTTGCATTACACCTTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9248
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035925 Nonsense 162 267 3 6
Genomic Location (Zv9):
Chromosome 12 (position 28170771)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26508380
GRCz11 12 26599740
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTTAGATTTTTTTTCCCCTTGCAGGTGTTTTAGAGGAAGCCGAGTTTTA[C/A]AACATTGCATCACTCGTGAGGCTTGTGAAGGAGAGAATACGAGACAATGA
Associated Phenotype:
Not determined