Busch Lab

ZMP

LOC793153

Ensembl ID:
ENSDARG00000025672
Human Orthologue:
ANTXR1
Human Description:
anthrax toxin receptor 1 [Source:HGNC Symbol;Acc:21014]
Mouse Orthologue:
Antxr1
Mouse Description:
anthrax toxin receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1916788]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa15102 Essential Splice Site Available for shipment Available now
sa38714 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27280
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030064 Nonsense 75 609 3 18
Genomic Location (Zv9):
Chromosome 8 (position 52680700)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 50125864
GRCz11 8 50114510
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTTCCCCCATTTGTTTACACATGTTTGTTCTTGCATTTAGCCCGCAGT[T/A]GCGAATGTCCTTCATTGTATTCTCCGATCAGGGCAAGATTCTGATGCAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27281
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030064 Essential Splice Site 448 609 16 18
Genomic Location (Zv9):
Chromosome 8 (position 52724198)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 50082565
GRCz11 8 50071211
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGCATGAGGAAACCGCCAGGCCCTCGAAAATGGTACTCGCCCATAAAG[G/A]TGAGAACAATACTGTTTTTAAAGGTGTTATAAAAACATTGTATATTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15102
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030064 Essential Splice Site 476 609 18 18
Genomic Location (Zv9):
Chromosome 8 (position 52745413)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 50062436
GRCz11 8 50051082
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCATAAANTATTATTGTTTTCTCTAAATATTTCTCTCTTCTYGTTCCCTC[A/T]GGGCMGCTGTATGAAYTTCACCCGCATCAAGTCCAATCCTCCACCKCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38714
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030064 Nonsense 485 609 18 18
Genomic Location (Zv9):
Chromosome 8 (position 52745442)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 50062407
GRCz11 8 50051053
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCTCTCTTCTCGTTCCCTCAGGGCCGCTGTATGAACTTCACCCGCATC[A/T]AGTCCAATCCTCCACCGCGGTATCCATCCTACAACCATCATTCCTCCCCC
Associated Phenotype:
Not determined