Busch Lab

ZMP

grma

Ensembl ID:
ENSDARG00000025671
ZFIN ID:
ZDB-GENE-021120-2
Description:
glutamate receptor, metabotropic a [Source:RefSeq peptide;Acc:NP_001073489]
Human Orthologue:
GRM6
Human Description:
glutamate receptor, metabotropic 6 [Source:HGNC Symbol;Acc:4598]
Mouse Orthologue:
Grm6
Mouse Description:
glutamate receptor, metabotropic 6 Gene [Source:MGI Symbol;Acc:MGI:1351343]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa10723 Essential Splice Site Available for shipment Available now
sa17675 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10723
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033657 Essential Splice Site 354 905 5 12
ENSDART00000114226 Essential Splice Site 358 909 4 11
ENSDART00000143677 Essential Splice Site 358 909 5 12
Genomic Location (Zv9):
Chromosome 11 (position 26591322)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25420147
GRCz11 11 25657763
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGGCTGAGGGTGCAGTAACCATCTTGCCCAAACGGGCATCCATTGAAGG[T/C]AAAAACTAAAGGCACATGTTAKTGTAATTAATGRAGGAAAAATGTGKTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17675
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033657 Nonsense 855 905 11 12
ENSDART00000114226 Nonsense 859 909 10 11
ENSDART00000143677 Nonsense 859 909 11 12
Genomic Location (Zv9):
Chromosome 11 (position 26609092)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25437917
GRCz11 11 25675533
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTTTGAGTGCCACGGTGTCCCTGGGCATGTTGTACATCCCCAAAGTCTA[T/A]GTCATCATCTTCCACCCCGAGCAGAAYGTGCAGAAGCGCAAGCGCAGCTT
Associated Phenotype:
Not determined