Busch Lab

ZMP

nvl

Ensembl ID:
ENSDARG00000025605
ZFIN ID:
ZDB-GENE-040426-2871
Description:
nuclear valosin-containing protein-like [Source:RefSeq peptide;Acc:NP_998649]
Human Orthologue:
NVL
Human Description:
nuclear VCP-like [Source:HGNC Symbol;Acc:8070]
Mouse Orthologue:
Nvl
Mouse Description:
nuclear VCP-like Gene [Source:MGI Symbol;Acc:MGI:1914709]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa42107 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42106 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42107
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038315 Essential Splice Site 316 796 10 23

The following transcripts of ENSDARG00000025605 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 396714)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 394697
GRCz11 13 524988
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCAGGAGAGTCTGAGCAGAAGCTGCGGGAGCTGTTCGAGCAGGCCATC[G/T]TAAGAGAAACACACAACACATTTACAGCGCTACATTCATTCAGTTCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42106
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038315 Nonsense 482 796 14 23

The following transcripts of ENSDARG00000025605 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 393923)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 391906
GRCz11 13 522197
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGCTCTGGCTCGTCTGCTGGATCTCCTGAAGAGCAGTGTTTCTCTGAGT[G/T]AGGATCAGCTGGCGGCTCTCTGCGTCCTCATGTCAGACTTCAGCTCTTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28038
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038315 Essential Splice Site 667 796 19 23

The following transcripts of ENSDARG00000025605 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 389907)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 387890
GRCz11 13 518181
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAATCCCTGAGGTGTGTTTCTGTGATGATTGTGTGTGTGTGTGTGTGTA[G/T]ACATCATTGACCCGGCTGTGCTCAGACCAGGACGACTGGACAAAACTCTG
Associated Phenotype:
Not determined