Busch Lab

ZMP

zgc:77177

Ensembl ID:
ENSDARG00000025593
ZFIN ID:
ZDB-GENE-040426-2480
Description:
Pleckstrin homology domain-containing family J member 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6P0G8]
Human Orthologue:
PLEKHJ1
Human Description:
pleckstrin homology domain containing, family J member 1 [Source:HGNC Symbol;Acc:18211]
Mouse Orthologue:
Plekhj1
Mouse Description:
pleckstrin homology domain containing, family J member 1 Gene [Source:MGI Symbol;Acc:MGI:1925920]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa39957 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39957
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037279 Nonsense 63 158 3 6

The following transcripts of ENSDARG00000025593 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 58675506)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 57741918
GRCz11 2 57856681
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTGCCTCTTTCTGTGTGTTTACAGCCCATCGGCGCTCTGCTGCTGGAA[C/T]AGTGTCGTGTGGAGAGAGAAGATCCTCAGGTTTTCTCTATCGGTAAAAGC
Long Flanking Sequence:
AAGAAATTAATAAATAATTCTCTCATTATTCTGGCATTTTGCAAATGTAAATCATTTAGGTAATCCTAACAGAACTAAATAGTAAACGTCTAGTGTGATTTACCATCAGACATTTATTTTTTAAATGGTTATGTTAATTTTTTAGTGCATGTAAACTTCTGGTTTCAACTGTAATTGAAATGTTCTTAAGAATGAAATATGATGTGTTCTCTGGAAGAGTGTTCTTGCATTGTGAGGATATTATTCTGGCATTCTAGCATTATATAATGAGTGGCATAAAATGGCCTGAAAATGACAAGTAGTAGTATCATTAATCGTAATATATTTTGGTGCAACATATCCTACAACAAAATATAGATATCGTGACAGGCCTACCGATTGGTACTGAAATCAATACTTTTGGTAATGCTAGTTTTACGAGATATTACAGTTTTGCAAGTCACAAGTTGAATCTGCCTCTTTCTGTGTGTTTACAGCCCATCGGCGCTCTGCTGCTGGAA[C/T]AGTGTCGTGTGGAGAGAGAAGATCCTCAGGTTTTCTCTATCGGTAAAAGCTGCGTCACTCACAGATTCACACTTCAGCTAACTGGGTTTATTTAAAGCACCAGCTCTGCTGTCTGTATCGCTTCCTAATTCATATAAACCACATATACTGACAGTACTTAAAATTCAGACACACAATTGAATTAAAATTATTCGTCCTTCTGTTAATTTTATTTAATTATTCCAATATTTCCCCAATGATGTTGAACAGATTCAGGAATTGTTCACAGTATTTCCTATAATATTTTTTCTTCTGTAGAAAGTCTTATTTGTTTTATTTCGGCTAGAATAAAAGCAGTTCTTAATTGTTTTAAAGCCATTTTAAGGTCAATATTATTCGCCCCTTCAGCAATATTAGTGTTGGATTGTCTCCAGAACAAACCACTGTTATACATTACTTGCCTAATTACCCTAACTTTACCCTAATAACCCTAGTGAAGCCTTTACATGTCACTTTAAGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5175
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037279 Nonsense 86 158 4 6
ENSDART00000037279 Nonsense 86 158 4 6

The following transcripts of ENSDARG00000025593 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 58676460)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 57742872
GRCz11 2 57857635
KASP Assay ID:
2259-2828.1 (used for ordering genotyping assays)
KASP Sequence:
ATTTGTTTTGACTGTTTTGCAGTGTTTTTAGACGAGGCGGAGCGRAAATA[T/A]CTGTTTGAATGTGATTCTCAGGAACAGTGTGCCGAGTGGATCGACGCCAT
Long Flanking Sequence:
CTTTACCCTAATAACCCTAGTGAAGCCTTTACATGTCACTTTAAGCTGTATAGAAGTGTCTTAAAGAATATCTAGTCTAATATTATTTACTGTCATCATGACAAAGATAAAACAAATCAGTTATTAGAGATGAGTTATTAACACTATTATGATTAGAAATGTGTTGAAAGAATTGCTCTGTTAAACAGAAACGGGGGGGAAATATACAGGAGGGGCTAATAATTCTGACGTTAACGGTGTACGTAGACATAACATGAAACTTTAGGTCATGAAAATGTACTTTAAAGTAATGGAGTTTTAGTTGTGGAAAATAAGACAATACTGTAAGAAAAGAATGGTGCAATTAATCGTTTTCTTGGTAGGAATTTTCCTTAAATCATAAATGCCAGTGATCTATATGGGACAGAAATAACCATACTCAATGTGCTTTTATTTCTTTCTTTATCTTTGATTTGTTTTGACTGTTTTGCAGTGTTTTTAGACGAGGCGGAGCGAAAATA[T/A]CTGTTTGAATGTGATTCTCAGGAACAGTGTGCCGAGTGGATCGACGCCATCATTAAAGCCAGGTGTGTGTATGTAAGATGCTGAAATCTGCTTGTTAAGTGGTGACGTGTTTGTGATGTATGTAATACTGTTTCCGGGTCCAAGCTGCCATTCATTTGAGTGGAGAAATCATTCGTTTATGATCATGTTTTATTCCTATCACACATTAAAGTTAACTTTATATAAAATCATAGTGTACACAACAATCTCTGGGCTTGCTGCATAACAAATACCAAAAATTTAACAATTTATAAAAAAATGAATCACTTTCTGGCCATTGGATAATATGCATGGACATATATACTGCGATTTGTGATTTTTTGAAAGCATTAAATCGCTTTGTAAACGTTTATTATTACCATTTCATGAGTCTCCCCATTCAGTTGAATAGAGCGCTTGGACCCGGAAGCCGCTTTGCGCGACGTCACACTTAACAAGCGGATTACCACAATCCTGTGCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18743
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037279 Nonsense 86 158 4 6
ENSDART00000037279 Nonsense 86 158 4 6

The following transcripts of ENSDARG00000025593 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 58676460)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 57742872
GRCz11 2 57857635
KASP Assay ID:
2259-2828.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTGTTTTGACTGTTTTGCAGTGTTTTTAGACGAGGCGGAGCGAAAATA[T/A]CTGTTTGAATGTGATTCTCAGGAACAGTGTGCCGAGTGGATCGACGCCAT
Long Flanking Sequence:
CTTTACCCTAATAACCCTAGTGAAGCCTTTACATGTCACTTTAAGCTGTATAGAAGTGTCTTAAAGAATATCTAGTCTAATATTATTTACTGTCATCATGACAAAGATAAAACAAATCAGTTATTAGAGATGAGTTATTAACACTATTATGATTAGAAATGTGTTGAAAGAATTGCTCTGTTAAACAGAAACGGGGGGGAAATATACAGGAGGGGCTAATAATTCTGACGTTAACGGTGTACGTAGACATAACATGAAACTTTAGGTCATGAAAATGTACTTTAAAGTAATGGAGTTTTAGTTGTGGAAAATAAGACAATACTGTAAGAAAAGAATGGTGCAATTAATCGTTTTCTTGGTAGGAATTTTCCTTAAATCATAAATGCCAGTGATCTATATGGGACAGAAATAACCATACTCAATGTGCTTTTATTTCTTTCTTTATCTTTGATTTGTTTTGACTGTTTTGCAGTGTTTTTAGACGAGGCGGAGCGAAAATA[T/A]CTGTTTGAATGTGATTCTCAGGAACAGTGTGCCGAGTGGATCGACGCCATCATTAAAGCCAGGTGTGTGTATGTAAGATGCTGAAATCTGCTTGTTAAGTGGTGACGTGTTTGTGATGTATGTAATACTGTTTCCGGGTCCAAGCTGCCATTCATTTGAGTGGAGAAATCATTCGTTTATGATCATGTTTTATTCCTATCACACATTAAAGTTAACTTTATATAAAATCATAGTGTACACAACAATCTCTGGGCTTGCTGCATAACAAATACCAAAAATTTAACAATTTATAAAAAAATGAATCACTTTCTGGCCATTGGATAATATGCATGGACATATATACTGCGATTTGTGATTTTTTGAAAGCATTAAATCGCTTTGTAAACGTTTATTATTACCATTTCATGAGTCTCCCCATTCAGTTGAATAGAGCGCTTGGACCCGGAAGCCGCTTTGCGCGACGTCACACTTAACAAGCGGATTACCACAATCCTGTGCAT
Associated Phenotype:
Not determined