Busch Lab

ZMP

slc25a3

Ensembl ID:
ENSDARG00000025566
ZFIN ID:
ZDB-GENE-040426-1916
Description:
solute carrier family 25 member 3 [Source:RefSeq peptide;Acc:NP_998887]
Human Orthologue:
SLC25A3
Human Description:
solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 [Source:HGNC Symbol;Ac
Mouse Orthologue:
Slc25a3
Mouse Description:
solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 3 Gene [Source:MGI Symbo

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa24590 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8051
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034704 Nonsense 31 356 2 8
ENSDART00000137077 Nonsense 31 279 2 7
ENSDART00000146154 None None 106 None 4

The following transcripts of ENSDARG00000025566 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 3363219)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3181414
GRCz11 25 3307158
KASP Assay ID:
2261-9254.1 (used for ordering genotyping assays)
KASP Sequence:
CGTTCAGCGCCCCGCTTTTYACCCTYCAGAAAGTGGAGGAGCCCGRAAYA[C/T]AAACCCCCGTACAGAAGCGGCGGCTCGCGGCAGCAGCAGTCGCCGGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24590
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034704 Nonsense 135 356 4 8
ENSDART00000137077 Nonsense 135 279 4 7
ENSDART00000146154 None None 106 None 4

The following transcripts of ENSDARG00000025566 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 3370267)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3188462
GRCz11 25 3314206
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCACCTTCATCGGTTACTCCATGCAGGGACTCTGCAAGTTCGGCTTCTA[T/G]GAGGTCTTCAAGATCCTGTACGGAGACATGCTGGGAGAGGTGAGAAACTG
Associated Phenotype:
Not determined