Busch Lab

ZMP

gucy2f

Ensembl ID:
ENSDARG00000025504
ZFIN ID:
ZDB-GENE-011128-7
Description:
retinal guanylyl cyclase 2 [Source:RefSeq peptide;Acc:NP_571939]
Mouse Orthologue:
Gucy2d
Mouse Description:
guanylate cyclase 2d Gene [Source:MGI Symbol;Acc:MGI:106030]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa22668 Essential Splice Site Available for shipment Available now
sa35912 Essential Splice Site Available for shipment Available now
sa42568 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1743
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099916 None None 259 3 19
ENSDART00000126196 Nonsense 385 1107 3 18
Genomic Location (Zv9):
Chromosome 15 (position 28716571)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29434601
GRCz11 15 29367477
KASP Assay ID:
554-1736.1 (used for ordering genotyping assays)
KASP Sequence:
CACAACGCCAGAAGAGCCGGTCGCTGGTTGTCCGGGACCAATCTGGCCTA[T/A]TTCACCAGGAACATTACATTCACTGGCTTCAACCAGGATATCCAAACAGA
Long Flanking Sequence:
TAATTATTAGCCCCCTATTGATTTTTTTTTTCTTTTTTAAGTATTTCATAAATTATGTTATAAATTTTCACAGTACGTCTCATAATATTTTTTCTTCTGGTGAGAGTCTTATTTGTTTTATTTTGGCTAGAATAAAAGATGTTTAGTTCAGTGAAGTTTGGTGTATGTGAAGCAATGGTTGCTGCAGTGGAAATTTAGTTATGAGAAAAACTTCTTTTGAGTTTGAGTTGTATATTGCATTTGAAGTCTGCAGACACAAATTGATAAAGTGCGACAAAAACCAACTTATAAAAACATAATTTGGATGTTTTCTCTACATTTCACTGAAAACAAGCATTGACAAATGCATGCTAATACAGTGTCTAGCCTAAAAAACATTCTGTTCCCTTTCAGGTCTCTCCGCTCTTTGGTACAATCTACAACAGTTTGTACCTCCTCGCCAAGTCCATGCACAACGCCAGAAGAGCCGGTCGCTGGTTGTCCGGGACCAATCTGGCCTA[T/A]TTCACCAGGAACATTACATTCACTGGCTTCAACCAGGATATCCAAACAGATGAGCAGGGAAACGGCCAGACCAACTATGTGATTCTGGACACTGAGGCCTGGGGCACTCAGCTGTATCGCTGCTTTCTGGTGGACATGACCTCAGATTTGGTGCTGTTTGCTGGCAGGTTCATTCATTTCCCTGGAGAGTCGCCTCCTCCTTCAGACTCCAGGTGCTGGTTTGAGGACAATGCCATCTGCACTGGAGGTACAACAAAAAATACCACACAATTTCTAGATTTTGTGTTCTGTAAGAAATAGACATTTGATTTTTAATGGCGTCATTGTTTTTTGCTTGAAAGTAATTTGTGTTGCTTTCAACTACTGTACATGTAAATTGTGGTTTCAGTGGCAGCAGTGTTCAAGCCTTATGTTTTATTACACTTAATATTTGTGGTACAACTTTTTATTTTTTACTTTAATTAGATAGTCAAATAAAAAAAATTGATTCATTAATTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22668
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099916 Essential Splice Site None 259 16 19
ENSDART00000126196 Essential Splice Site 1019 1107 15 18
Genomic Location (Zv9):
Chromosome 15 (position 28724744)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29442774
GRCz11 15 29375650
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTGGAGACACAGTCAACACCGCCTCTCGTATGGAATCTACAGGGTTGC[G/A]TATGTTCCATTTAGATTTCTTTTTTACAGATGTGATATGGAAACATTGTG
Long Flanking Sequence:
ACCATAAAAAAATGAGTAAACTAAAAATTTTGTCAGCATTTACTTACCCTTTGCTTCTACCAAACTTGTTTGAGTTTCTTTCTTCTTTTGCACACAGGAAAGATATTTTGAAGAAAGCTGAAAACCTGTAACCATTGACCTCCATAGTATTAGTTTTTTTTACTATGGAAGTCAATGTTTACCATTTTTAGCTTTTTTAATGTTCAACAGAATAAAGATACTCATAAAGGTTTGGAGCAACATTTTCATGAATACATTTTCATATTTGGATGAACTAATTATGTGCAGAATTATAAAATGTGCATAATTTTAAAAAATCAAGTTAATGAATTTACTCTCTTTGTTAAGTACAGTATTGAATTGCTCTTTACCGTATCTTATCCTGTTTGTTCTCTATCCAGGGCCGTGTGTTGCTGGAGTCGTGGGTCTAACTATGCCTAGATACTGCCTTTTTGGAGACACAGTCAACACCGCCTCTCGTATGGAATCTACAGGGTTGC[G/A]TATGTTCCATTTAGATTTCTTTTTTACAGATGTGATATGGAAACATTGTGTGCTGTATTTGGATACTCTGTTAACAAACATTATTTCCTTCAGCTTACAGAATTCATGTGAACATTAGTACAGTGCAAATTCTCCGCTCACTGAATGATGGCTACAAAATAGATGTTCGTGGAAAGACTGAGCTGAAGGTACTAACACAAATGTTTTCTTTTACAGATTATAACTAGCAAAATAAAATTTGAACAGGCATTGAAAGTTTGGGGTCAGTTTAATTTGATTTTTAATTGTTTTAATTCGGCAAGTAGGCATTAAGTTTATAAAAAAGATTCATTAAGATTTGTTCAAATTTGTCGGTGCCAATAGACTAGTGGTTAAGTGCTTTGACAATACATTCTATCTGCTCCCAAAACTTTCCTGTCTGTCCTGCATTATCCTATCCTAATTAAAGACAGAAAACCCTAAAATATTGTCATATTCTATCGTAAATGAATTCTGAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35912
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099916 Essential Splice Site None 259 None 19
ENSDART00000126196 Essential Splice Site 1020 1107 None 18
Genomic Location (Zv9):
Chromosome 15 (position 28724745)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29442775
GRCz11 15 29375651
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGGAGACACAGTCAACACCGCCTCTCGTATGGAATCTACAGGGTTGCG[T/G]ATGTTCCATTTAGATTTCTTTTTTACAGATGTGATATGGAAACATTGTGT
Long Flanking Sequence:
CCATAAAAAAATGAGTAAACTAAAAATTTTGTCAGCATTTACTTACCCTTTGCTTCTACCAAACTTGTTTGAGTTTCTTTCTTCTTTTGCACACAGGAAAGATATTTTGAAGAAAGCTGAAAACCTGTAACCATTGACCTCCATAGTATTAGTTTTTTTTACTATGGAAGTCAATGTTTACCATTTTTAGCTTTTTTAATGTTCAACAGAATAAAGATACTCATAAAGGTTTGGAGCAACATTTTCATGAATACATTTTCATATTTGGATGAACTAATTATGTGCAGAATTATAAAATGTGCATAATTTTAAAAAATCAAGTTAATGAATTTACTCTCTTTGTTAAGTACAGTATTGAATTGCTCTTTACCGTATCTTATCCTGTTTGTTCTCTATCCAGGGCCGTGTGTTGCTGGAGTCGTGGGTCTAACTATGCCTAGATACTGCCTTTTTGGAGACACAGTCAACACCGCCTCTCGTATGGAATCTACAGGGTTGCG[T/G]ATGTTCCATTTAGATTTCTTTTTTACAGATGTGATATGGAAACATTGTGTGCTGTATTTGGATACTCTGTTAACAAACATTATTTCCTTCAGCTTACAGAATTCATGTGAACATTAGTACAGTGCAAATTCTCCGCTCACTGAATGATGGCTACAAAATAGATGTTCGTGGAAAGACTGAGCTGAAGGTACTAACACAAATGTTTTCTTTTACAGATTATAACTAGCAAAATAAAATTTGAACAGGCATTGAAAGTTTGGGGTCAGTTTAATTTGATTTTTAATTGTTTTAATTCGGCAAGTAGGCATTAAGTTTATAAAAAAGATTCATTAAGATTTGTTCAAATTTGTCGGTGCCAATAGACTAGTGGTTAAGTGCTTTGACAATACATTCTATCTGCTCCCAAAACTTTCCTGTCTGTCCTGCATTATCCTATCCTAATTAAAGACAGAAAACCCTAAAATATTGTCATATTCTATCGTAAATGAATTCTGAATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42568
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099916 None None 259 18 19
ENSDART00000126196 Nonsense 1076 1107 17 18
Genomic Location (Zv9):
Chromosome 15 (position 28726790)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29444820
GRCz11 15 29377696
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGGCTTGTTGGGAAAGCTAATTTTACTAAGCCTTTGCCAAATCCACCA[G/T]AGATCAAACCAGGGTAAGATTTTAATATTATTTTAACATAATTTTTTACA
Long Flanking Sequence:
AAATGAAAAATGCTTGCTGGGAAGGTATTTGTAGCTCCGCCCTCTTTTGAAAAGTACAATCTCATTTAAATTTAAAGCAACAGTCACCAAAACGCCACAATTAGGATCAAAGGGGTCATTTCAAAGTGTTTTAAAACATTATTTGGGTGGTATTTTGAGCAACTCACATACACACTCTAGGGACATCAGAGACTTAATTTACATCTTGTAAAATGAAGCTTAATAGGTCCCCTTTAAATTGTTTTATTTTTTCAAATATATTCAAATAGAAAGGAGTTATTTTAATGGGATTTGGGATTTGATCATATAAATGTAGCCTTGATGCGCAAAAGAGGTTTCTTTAAAAACATTTTGAACAGTAGCGTATGCACTTAAATACTGTAAGTACTTGTTTATCGTTTAATTAATGTGTTATTAACTGTTTATAGGGGAAAGGCATTGAAGAAACATACTGGCTTGTTGGGAAAGCTAATTTTACTAAGCCTTTGCCAAATCCACCA[G/T]AGATCAAACCAGGGTAAGATTTTAATATTATTTTAACATAATTTTTTACATGTATTTAATTTTTTTTATTGCTAAAGTTTTAAATGAATGAACGAAATATGTGAACTAGTATGGTCTTTTGATTCAATTGGAGTATCTTACTCACTTGCACCATTTATTAATGTACAAATATAAAAAAACACATTGTACTTTAAATAAATGTGTGCTATTAAATCTCTCTGTATATGAATGAATGGGATACTATTTATGGATTGGAAAATTGGATTTATGCCTCAGGGAAGACAACCATGGTTTGAAACCTGAGGACATTGAGGCTTACAAGAGAAGGAAAGCTGAGAAAAAGGCATGATCTCGTAGCCAAATGCAAGGAGGTAGTACCTTGCATGCTGTTGTGTATTTGTCATGTGGTCAGAGTGACTTTCGGTGGGGTTGTGTCGTGTTGGTGTTCACTGTGGCTTTGCAAAAACTGCTTGTTTATTAGTGTGTGTTGTGTATTTTTT
Associated Phenotype:
Not determined