Busch Lab

ZMP

aatf

Ensembl ID:
ENSDARG00000025467
ZFIN IDs:
ZDB-GENE-030131-9654, ZDB-GENE-030131-9654
Description:
protein AATF [Source:RefSeq peptide;Acc:NP_001077297]
Human Orthologue:
AATF
Human Description:
apoptosis antagonizing transcription factor [Source:HGNC Symbol;Acc:19235]
Mouse Orthologue:
Aatf
Mouse Description:
apoptosis antagonizing transcription factor Gene [Source:MGI Symbol;Acc:MGI:1929608]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa12249 Nonsense Available for shipment Available now
sa20541 Essential Splice Site, Missense Available for shipment Available now
sa11464 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12249
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028854 Nonsense 76 576 2 12
ENSDART00000130583 Nonsense 79 570 2 13
Genomic Location (Zv9):
Chromosome 5 (position 57689329)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55609928
GRCz11 5 56280145
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATCTGCGGAAACGCTCTGGGGCCATTCTGGCTGATGGTGACCAACGATA[T/A]YGTGGAAAGGCAACATCCAGAAAAGACCTACAGAAAGAKTTGGATGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20541
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028854 Missense 96 576 3 12
ENSDART00000130583 Essential Splice Site 97 570 None 13
Genomic Location (Zv9):
Chromosome 5 (position 57689484)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55610083
GRCz11 5 56280300
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAGGGATTGTCCAACTCACAATATGTTTTGCACATTTTTAGCAGATGA[A/T]GATGATGATGATAATGATGATGGTGTTGATGATGAAGATGAAAGTGGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11464
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028854 Nonsense 355 576 6 12
ENSDART00000130583 Nonsense 349 570 7 13
Genomic Location (Zv9):
Chromosome 5 (position 57698978)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55619577
GRCz11 5 56289794
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATATGGATGAAAATGAAGGTGATGACCAAGAGGTAGAACAGAAAGCAGCT[C/T]GAAACRGACCTCCCAAACGAAAAMTGGAAATGGCAGATTATCCCAAYTTT
Associated Phenotype:
Not determined