Busch Lab

ZMP

admp

Ensembl ID:
ENSDARG00000025372
ZFIN ID:
ZDB-GENE-011214-1
Description:
anti-dorsalizing morphogenic protein [Source:RefSeq peptide;Acc:NP_571951]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa15652 Essential Splice Site Available for shipment Available now
sa33054 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25934
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037557 Nonsense 107 391 2 5
Genomic Location (Zv9):
Chromosome 2 (position 54084510)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 53769490
GRCz11 2 53497713
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTATTTATTTCTCACCATGTTTTCTCTTTAGTGCACAGTGAACGAATC[G/T]AGTATCTCTTCAACATGTCCACTGTAGCCAAGAGTGAGAAGATCCTGACG
Long Flanking Sequence:
GTGATGATGGTTACAGTTTGTGTGTAAAAAATGTTTAGTTATGGTCAAAATTATTCGCCATCCTGTGATTTTTCTTTTTTAAATATTTCCCAAATGACGTTTAACAGATTCAGGAATTTTTTAAACAGTATTCCCTATAATATTTTTTTGTTCTGGAGAAAGTTTTATGTTTTATTTTGGCTAGAATAAAAGCATTTTTAAGTTTTTTAAAAACATTTTAAGGCCAATATTATTAGCCCCCTTAAGCAGTAATGCTTTTCAATTGTCTGCAGAACAAACCATCATTATACAATGACTTGCCTATTTACGCTAACTTTAACCTAGTTCAGCCTTTAAATGTCACTTTTAAGCTGAATACTACTATCTTGAAAAATATCTAGTCAAGTAAAATAATAAATAAAATAAAAAGCATACATTAATTCACCAGGGCTAATAATTCTGACTTTAATGTGCTATTTATTTCTCACCATGTTTTCTCTTTAGTGCACAGTGAACGAATC[G/T]AGTATCTCTTCAACATGTCCACTGTAGCCAAGAGTGAGAAGATCCTGACGGCTGAACTTCACCTGTTCAAACTCAGACCAAAAACATCAATCGTCTTAAACAGACATCACTTCTGTCAGGTACAGCAATGGGTGTACACTGTCAAAATACCATATAATTACCACTGCACTGTTTAAAAAATCTGTTGATGAATAGTTTCTGTGTTTTGTTATTTACAAGTGTTTCCCGTTTATTTACGGTTGTATATTGGGTTATGGGATGTTGCTCTCTGCTCTGTCGACTTCTGGTGTTAAATTCAACTCTACAGTTTACCAAAGTGACTTTCATTAACGTTTTAGTAGTTTGAAATAATATAATGCATAAGAAATGTGTATATATAGAGAAATGTGTCTGTAAAAGAACAGAAAATTTGCTGGCCGTGGTGTTTGTACACCAACCAAAACAATATAGCGCTTTATTAAAATTGTTCAAAAAAGCTCCCATAATGCAATACAAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15652
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037557 Essential Splice Site 187 391 3 5
Genomic Location (Zv9):
Chromosome 2 (position 54080816)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 53765796
GRCz11 2 53494019
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTTCCMATTCACTCTACTGGCTGGGAGGTTTTYACCATCACTCAAGCTG[T/C]AAGCATYAACTAAAGACTTMCTTTCAGACATTTACTAAAATATTTTAACT
Long Flanking Sequence:
AACTAGGTTAATTAAGTTAATCAGGCAAGTTAGGGTAATTAGGCAAGATATTGTATAACAATGGTTTGTTCTGTAGATTATCGAGAAAAAATATAGCTTAAAGGGGCTAATAATTTTGTCCCTAAAATGATGACTAAAAAAATAAAAAAATGCTTTTATTCTAGCCGAAATAAAACAAATAAGACTTTCTCCAGAAGAAAAAAATATTATCTGACATACTGTGAAAATTTTCTTGCTCTGTTAAACATCATTTAGAAAATTTTTTTTTTTAAAATTTGAAGGGGGGCTAATCATTCTGACGTCAGCTGTATATCCTTAATTGGTACTGTCATATGCACCTGCAAGTGTTTTGGATTAATGTGATGTTTTTGTGCAGGTCAGTGTGTATCAGGTTCTGGACAGCAGCAAAAAAAACGTCTCGCAAGGGAAGAAGCTGCTCTCATCCAGACTGGTTCCAATTCACTCTACTGGCTGGGAGGTTTTTACCATCACTCAAGCTG[T/C]AAGCATTAACTAAAGACTTCCTTTCAGACATTTACTAAAATATTTTAACTGTACAGTGTAAAAATGCTGGGTTGCATTTGTGTTGTGGAAACATGAAGGAATTCAATTCAATTTATGTTTATTTCCATAGCACTTTTACAATGTAGATTGTTTTAGCGTCACATAGAAGTTCTAGTGAATGGAAACAGTGTCAGTCCAGTTTTCAGAGTTGAAGTTCAGTTTAGTTCAGTTCAGTGTGATTTAATTTTCACTGCTGAGAGTTCAAATACTGAAGAGCAAAAAAATGTTGACTTATTAGTTTTTACAAAGTGGACTGAACATAAAACTATTAATTTGTCCCAAAACAACTTAAAAATTGTGTTGTTTCAACTAATTCTATATAAGTAGATTGAACAAGCAGCAAAAGTAATTTTTTAAGTGTACAATGTTAGGGTGAACCAACATGGGGGTTCTAACATGGCGACTAGCTAGACAGACATACAACTCGACACTCCTACCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33054
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037557 Essential Splice Site 253 391 5 5
Genomic Location (Zv9):
Chromosome 2 (position 54072303)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 53757283
GRCz11 2 53485506
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTAGCGGGAGCACTTTTCTGACTTCCTCCTCATCTCTTGTTCTCCGCA[G/A]GTTCAGATGTTTCTCCTGGCGGCTCCAGTCAGCCGCTTCCCAGTGTCCCG
Long Flanking Sequence:
ATCTCCCGGTAATCTCGCGTCTCCCTCCCGGCCCTCAAATAGGCTACGTCGCGCACCCTCCTCACCGCATCCCTCCTCGCTCTTCAGACACGTCGCACGCACCTTTTCAAACACCACCAAACCACCACCTCTTCTGACAGCTGAGCGGGACTCAACAAAATAAACCCTGACTCTGACCAATGTGAGGAGAGTTTACTCACACGTGACTTGTTTTAGCTCTTTTGGTCCGATTAGAAACTTTGCCGTGTGAAAGTGAACCGCACCAAGAGCAAAGAGCAACAATGTAACAATTGTAATCTCTGTTTCAGAACAACTGAATCGATTCACAGGTGTGAAAGCAGCCTTAAAGTGACACTCCATGTTAATTTTGAAAATATTCTCATTTTACATCTCCTCTAGTGTTAAACACTTGAATTGTATAGTTTTTGTATCAATTTAGTCGATCTCCGGGTCTAGCGGGAGCACTTTTCTGACTTCCTCCTCATCTCTTGTTCTCCGCA[G/A]GTTCAGATGTTTCTCCTGGCGGCTCCAGTCAGCCGCTTCCCAGTGTCCCGGCGTCCCGGCGTAGCTCTCGCTCTGTGGATTATGACGAGAGAGGAGAAAAGATGGCCTGTCAGCGTCAGCCGCTGTACGTTGACTTTGAGGAGATCGGCTGGTCCGGTTGGATCGTATCTCCCAAAGGATACAATGCGTATCACTGCAAAGGCTCCTGTATATTTCCCTTGAGCCAGAATATGAGGCCCACGAACCACGCCATCGTCCAGTCCATCATAAACACCCTCAAACTCAACAAAGGCATTCAGACGCCCTGCTGCGTCCCGGACAAACTCTACAGCATCAGCCTGCTATACTTTGATGATGACGAGAATGTGGTGCTGAAACAGTATGATGATATGGTGGCCGGAAGCTGCGGGTGTCGCTGAAAAAAAAAAAAAAACAGATTTACCTCAGTGTTTAATGCAAAATCTGGATAAAATTGTAAATATGTACATAGATAGACAATA
Associated Phenotype:
Not determined