Busch Lab

ZMP

znf277

Ensembl ID:
ENSDARG00000025346
ZFIN ID:
ZDB-GENE-040426-1633
Description:
zinc finger protein 277 [Source:RefSeq peptide;Acc:NP_956724]
Human Orthologue:
ZNF277
Human Description:
zinc finger protein 277 [Source:HGNC Symbol;Acc:13070]
Mouse Orthologue:
Zfp277
Mouse Description:
zinc finger protein 277 Gene [Source:MGI Symbol;Acc:MGI:1890393]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa30252 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16599 Essential Splice Site Available for shipment Available now
sa44302 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30252
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121878 Essential Splice Site 99 457 2 12
Genomic Location (Zv9):
Chromosome 25 (position 22395455)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21627331
GRCz11 25 21724879
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCATAAACTGGTTATCGCTGATGTCAAACTCATTGCAGACTTTTCACAG[T/G]AAGGCTTGATGATTTTTAACCCACATGATGTAAGAAATAAAATACATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16599
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121878 Essential Splice Site 291 457 8 12
Genomic Location (Zv9):
Chromosome 25 (position 22409572)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21641448
GRCz11 25 21738996
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGAAKTGCAGTCTGAAGACGACCGAGAGATGCTTGAAGAYGAAGATGAG[T/C]AAGACCTTTATATTTTWAATGTTCGTTTTCAGATNAATGTAATAAATATSG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44302
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121878 Essential Splice Site 396 457 12 12
Genomic Location (Zv9):
Chromosome 25 (position 22414151)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21646027
GRCz11 25 21743575
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGGTTCTTATACAATAAAAATGTAAAGTGTTATTCACGTTTTGTTTTTC[A/T]GATACTACTTTCCTACATATGAGAACGATGCTCTTCTTACAGCTCTGTCG
Associated Phenotype:
Not determined