Busch Lab

ZMP

fynb

Ensembl ID:
ENSDARG00000025319
ZFIN ID:
ZDB-GENE-050706-89
Description:
tyrosine-protein kinase Fyn [Source:RefSeq peptide;Acc:NP_001025140]
Human Orthologue:
FYN
Human Description:
FYN oncogene related to SRC, FGR, YES [Source:HGNC Symbol;Acc:4037]
Mouse Orthologue:
Fyn
Mouse Description:
Fyn proto-oncogene Gene [Source:MGI Symbol;Acc:MGI:95602]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa18008 Essential Splice Site Available for shipment Available now
sa17760 Nonsense Available for shipment Available now
sa3055 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa18008
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036635 Essential Splice Site 155 544 6 14
Genomic Location (Zv9):
Chromosome 20 (position 397031)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 387626
GRCz11 20 376261
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATTCCCAGCAACTATGTCGCCCCAGTGGACTCAATCCAGGCTGAAGAG[T/C]AAGNNNNNNNTCTGTGTGTCTGAAATMAGTGWGTGAACAGYGTGTCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17760
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036635 Nonsense 229 544 8 14
Genomic Location (Zv9):
Chromosome 20 (position 400366)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 390961
GRCz11 20 379596
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCGCAAACTGGACAGTGGAGGCTACTACATMACCACTAGAGCTCAGTTY[G/T]AGACCCTTCAGCAGCTGGTCCAGCATTACACCGGTANNNNNNNNNNNNNNNNNNACACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3055
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036635 Nonsense 361 544 11 14
ENSDART00000036635 Nonsense 361 544 11 14
Genomic Location (Zv9):
Chromosome 20 (position 411853)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 402448
GRCz11 20 391083
KASP Assay ID:
554-2632.1 (used for ordering genotyping assays)
KASP Sequence:
TAAAGCTAACATGTGAATGTGGCGYGTTTCAGGCAGTCTCCTAGATTTCT[T/A]GAWGGACGGAGAGGGACGAGCGCTGAAACTGCCCAACCTGGTGGACATGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5667
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036635 Nonsense 361 544 11 14
ENSDART00000036635 Nonsense 361 544 11 14
Genomic Location (Zv9):
Chromosome 20 (position 411853)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 402448
GRCz11 20 391083
KASP Assay ID:
554-2632.1 (used for ordering genotyping assays)
KASP Sequence:
TAAAGCTAACATGTGAATGTGGCGYGTTTCAGGCAGTCTCCTAGATTTCT[T/A]GAWGGACGGAGAGGGACGAGCGCTGAAACTGCCCAACCTGGTGGACATGG
Associated Phenotype:
Not determined