Busch Lab

ZMP

tcerg1a

Ensembl ID:
ENSDARG00000025314
ZFIN ID:
ZDB-GENE-030131-1791
Description:
transcription elongation regulator 1 [Source:RefSeq peptide;Acc:NP_938171]
Human Orthologue:
TCERG1
Human Description:
transcription elongation regulator 1 [Source:HGNC Symbol;Acc:15630]
Mouse Orthologue:
Tcerg1
Mouse Description:
transcription elongation regulator 1 (CA150) Gene [Source:MGI Symbol;Acc:MGI:1926421]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22557 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22557
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105466 Essential Splice Site 646 999 13 22
ENSDART00000131841 Essential Splice Site 675 1049 14 21
ENSDART00000137685 Essential Splice Site 646 812 13 20
ENSDART00000141733 Essential Splice Site 646 1020 13 20
Genomic Location (Zv9):
Chromosome 14 (position 53474710)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 51789045
GRCz11 14 52504739
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAAGGATGACTTCAGGAAAATGATGGAGGAATCGAAACTGGGTGTCAGG[T/C]GAACACTGAGAGCTCATTTAATGCTGCTGAATGAGTGTCTGTGATGCTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28371
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105466 Nonsense 891 999 19 22
ENSDART00000131841 Nonsense 941 1049 19 21
ENSDART00000137685 None None 812 18 20
ENSDART00000141733 Nonsense 912 1020 18 20
Genomic Location (Zv9):
Chromosome 14 (position 53465120)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 51798635
GRCz11 14 52514329
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCACGTCTTGGAAGGAGGTGAAGAAACTCATCAAAGAAGATCCCAGATG[C/A]ATCAAGTTCTCCAGCAGTGACCGAGTAAAGCCTCTCTGTTATTACTGAAA
Associated Phenotype:
Not determined